SimpleSearch - Line and FST details


Line specific information

 
Line ID 068A03
Vector Used pAC161
Line Availability only available from NASC (N406435)
Segregation Analysis 100:92:59
Confirmed for Hit At3g19590
Parent of DUPLO pair 2572
Parent of pair(s) none

Gene hit At3g19590

 
Sequence (A. th genome BLAST matches underlined)
>17-011756-strizhov-A3-8409
TTTGATCCATGTAGATTTCCCGGACATGANAGCATTTACAATTGAATATATTCGAGATGA
TCACTGTTATTAGAAAATCGGAGATTATAAATGCCGTCGGACGGGGGATTCGAAAGCTCA
CAGCCGGCGGACGGAGTCACAGTCGTCATTTTTCCCGTTGAAGATCACAAATGCTATGGG
ATCCTCCCTATAGTGAGTCGTATTACTCATCCGGCTTCAGAGACGGCGCTGATTACAAAG
TCCGACGGAATTGGCTCTCTTTTCTCTCAGGCATGTGAAGAGACTGTTGGCATAATAATG
TTTCCCCTCAGGCTAATTTAACATTGGCTGCTCAAAAGTTGTTGATTTTACTGCCATTTT
TTCTTCATATTTTGACACTGTGACGGCTATGGAATCTTTCTACATTTAGCAAATGCCTTG
AATCCGTTGCATAATGTCCTTAATTTATAAGGGGTCATCTGGTTTTACTGCAGGATTGTA
TTCAATGTCGGGCAAAAAGACATTTTTGGGGACCCATGACCAAGCAGGGCGATGTGTTTA
GTATTCCTACGC
GenBank Accession AL755224 [GenBank]
Graphic View Graphic view of gene At3g19590
Predicted Position of Insertion Chr3:6805961 - go to primer design
BLAST e Value 8e-135
Hit Clone Code (BAC ID) MMB12
Hit Gene Code At3g19590 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40