SimpleSearch - Line and FST details


Line specific information

 
Line ID 068A07
Vector Used pAC161
Line Availability only available from NASC (N406439)
Segregation Analysis 50:40:29
Confirmed for Hit At1g02250
Parent of DUPLO pair none
Parent of pair(s) 58479, 92302, 92303

Gene hit At1g02250

 
Sequence (A. th genome BLAST matches underlined)
>49-011756-strizhov-A7-8409
TTGATCCATGGTAGATTTCCCGGACATGCAAGCCTTTACAATTGAATATATCCTGCCAAG
CTATCAGTTTTGTTTAATACGACAGATTTCCATTCAAACTTTAACCACTTGTCCTATGGG
ATCCTCCCTATAGTGAGCCTGATTACTCTAGACCCTGCAGACACCGGTCAATGGCTTTTG
AGGTGTGTGGCTGTTGCGATCATCTTGCATAGAAACAATCTTACCCTGCTCATGGTCATC
ATTAAAAAACCCTTTGAACTCATCACTCAAAATATCGCCGAACTCCCTATCTATGGGATC
CTCCCTATTGTGAGCCCTAGTACTCACGGCCCGACGTGGACGGACCCGGCCCCCCCCTAT
AGGTCAATCCAACCCCTCCGCTGCTATGGCGCAGTCGGCTTCTGACGTTCACGGCTATCC
GCCCTTTGAAAACAACTTGTCGCACAAGTTCTAACTTACGCGACAGGCTGCCGCCCTGCC
CTTTTCCTGACGTTCTCTTGACGCGTGACATAGTCACCTAAGATATACTTCTTGCGACT
GenBank Accession AL755227 [GenBank]
Graphic View Graphic view of gene At1g02250
Predicted Position of Insertion Chr1:438375 - go to primer design
BLAST e Value 6e-49
Hit Clone Code (BAC ID) T7I23
Hit Gene Code At1g02250 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23