SimpleSearch - Line and FST details


Line specific information

 
Line ID 068D09
Vector Used pAC161
Line Availability only available from NASC (N406477)
Segregation Analysis 100:78:53
Confirmed for Hit At1g07520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g07520

 
Sequence (A. th genome BLAST matches underlined)
>68-011756-strizhov-D9-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATTCATAATTGTT
GAGTGGAAAAAAGTAGGAGGAGGCATAAAGGTGAGAACTTTATCGATCAATTCATTAAAA
AGAGATAATTTAAGGACATGTTGGCGAAGAGTAATATTCAAATGGGATTGGGTATAATTG
CTAAGCGTGAGAGAAGAAGCAAGAAATTGAGAACTGTAGAGAGATTAGAGGAAGGAGGAA
GTTTCCCGGGAAACTCGAAAGGGGGACAAGACCAGTCTTGCGATTCGTCCGAGGAGTCAA
AACTCAAAACTATCTCTCTTTTGACTTGTCATTAAGAGTATTCTTGGGCTTGATGGGCCC
AGTTTTTATTGTAGTGATTGTCATGTTATCCACAAAAAGTAATGACTATGGGATCTTTCC
TATAAGGGATCGGTTTACTAATTCCCCCATATGTTGACCGCTTATCGAAGCTTAAATGAT
CCATATGTTTGTTGATACTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession AL755255 [GenBank]
Graphic View Graphic view of gene At1g07520
Predicted Position of Insertion Chr1:2311973 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F22G5
Hit Gene Code At1g07520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAS family transcription factor
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX285149 [GenBank]


Last Updated on 14.10.2014 10:23