SimpleSearch - Line and FST details


Line specific information

 
Line ID 068E03
Vector Used pAC161
Line Availability only available from NASC (N406483)
Segregation Analysis 100:55:41
Confirmed for Hit At1g51340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g51340

 
Sequence (A. th genome BLAST matches underlined)
>21-011756-strizhov-E3-8409
TTTGATCCATGTAGATNTTCCCGGACATGAAAGCATTTACAATTGAATATATCCTATGCG
ATGGAGGCTGAAGAGCACTTGAAACATGCTCTTTCCTCTAAAATTCCTCGGTTAGCTCCT
AAAAAAAGACCAGAGGAACCTGTCCCTGTCCCAATCCTGTTACACACACATTGACATTGT
GTTATAAGAAAGTGGGAAAAGTACTTACATTCGTACTACAAGAAACGAGATTTTCACAGA
GTCTTACCGTCAGAGTCAAACGGCTGCTCTAAGACTCATGTCACTGGTGAAACCAAACCA
ATTTCCACTAAGACCCTGACTCGATGACAGGAAGAGCACCCACCCGATGCTAACTGTAGC
CACCATCACTAATGAAGCTTCGGCGTAACCGATATTGAATGCTCCAGAGTTCACTCTATG
AAACACAAACTGCTAAGCATTAATTGGTTGCGCTACTGGCTCACACTCTGCGATACAAGA
GATGATTTTTAGCCAAAGTAATGTTACGTCATAATATTGATACTGAGTACTGGGGGAATC
GGAAATGATTAATTACCGGAACGTCCTATGCTATTAGGGTGTAAAACTTATCGTCTTTTG
TAACACCTCTGCTCCAAAATGCAATCCTGCTCAAGGTTAACCGCAAGTACCAAACC
GenBank Accession BX546521 [GenBank]
Graphic View Graphic view of gene At1g51340
Predicted Position of Insertion Chr1:19034736 - go to primer design
BLAST e Value 5e-99
Hit Clone Code (BAC ID) F11M15
Hit Gene Code At1g51340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MATE efflux family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40