SimpleSearch - Line and FST details


Line specific information

 
Line ID 068G09
Vector Used pAC161
Line Availability only available from NASC (N406513)
Segregation Analysis 100:86:61
Confirmed for Hit At4g11140
Parent of DUPLO pair none
Parent of pair(s) 11102

Gene hit At4g11140

 
Sequence (A. th genome BLAST matches underlined)
>71-011756-strizhov-G9-8409
ATTGTGGATAATAAGGAACCCACTTTAAACGGCTCAGATCTCTCTCCGCCGGTGATTTCG
GCACGACGACGAAATTGGCTTCTCGACGTCAAAGATTGAAAGTTTCGGCGGCTATTTATT
AGGAGATAATCTTTTTGCGGATATGAGTATGGGATCCGGGTTCGGATTCGGGTCTGGGAC
TGGATTCTCCAGCTGGCACGTTGAGGACCATTTTCAAGATATTGGGGATTTATCCGGGGC
GCATCCTGTCTTAACTGATCAAGAAAAAACTGGCCCGTGAACGGCGTTTAGTGAAGCCTT
GTTACCG
GenBank Accession BX546522 [GenBank]
Graphic View Graphic view of gene At4g11140
Predicted Position of Insertion Chr4:6795315 - go to primer design
BLAST e Value 6e-80
Hit Clone Code (BAC ID) T22B4
Hit Gene Code At4g11140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytokinin response factor 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40