SimpleSearch - Line and FST details


Line specific information

 
Line ID 070F03
Vector Used pAC161
Line Availability only available from NASC (N406687)
Segregation Analysis 100:86:78
Confirmed for Hit At2g31900
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g31900

 
Sequence (A. th genome BLAST matches underlined)
>22-011732-strizhov-F3-oriL
TTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTACAATTGAATATTTGCCTTGTTT
CGTGCGGACGACCTCTGGTGCTATCGGACCTCTCCCTAGGGAGCGTCGCATATACTCACA
TCCCTCTGAAAATGGTTGCATTCCCTACAATGTTGTTACCAACTATTACTGAGGCTCTTA
AAAAATGGATTAATCGGAGGTTCACTTTACCAAGCTTACTTGAACCAATCTCCCAAATAG
TGTAGCATGGGATGATCTGTTACGTCTTGAAGCCGCATTATTTGTATTGCTGAACTTGAG
TGTAGATTGGAGAAGATATAAGAGGGTAGAGCTTGTTGTGAGCCAATAAGCTATGGGATC
CTCCCTATAGTGAGTCGATTTACTCAANNNGGGNNGGNNGGGNGGGGGGGGGGGAGGGGG
GAGGGGGGGGGGGGGAGAGGGGAGAAGAAAAAAGGGGGGGGGAGGGGGAGAGAGAAGAAG
AGGAAAAGAAGGAGAGAAGGAGGAGAAGGGAGAGGGGAAGGAAAGAAAGAGGAAGAGGAA
AAAAGAGAAGGGGGAAAAGAGAGAGGAGAGAGGAGGAGAAGAGAGAGAAAGAAGGGGAGA
GAAAGAAGAGAAAGAGAGAGGGAGGAAAAAAGAAGGAGAAAGGAAGAAAGANAAGAAAAA
AAAAGGGAAGGAAGGGAAGGGGAAAAGGNAGGAGGAGAGAAGAGAGAAGAGAAAAAAAGA
AAAAAGGGGGGAAAAAAAAGAAGAGAAAAAGGGAAGAGGGAAGAAAGAAGAGGGAAGAGA
AGAGATGGGAGAAAAGAAAGAAAAAAGAATGGATGGAAAGAAGAACAAGAAGAGAGCGGG
AAAAGGAGAGAGGAAACTCATAGAGTAGGTATAAAGAAGAAGAAGATAAGATAAGACATA
AAAACGGAAGACAATAAGCGACTTCTGTCTCACTGACATGCATAATGAGTAGAACTGCTT
CGGGTGTCAGTATAATATAGAAAAGAACATAATGGCGAATAATAAAGAGGAGAAAGAAA
GenBank Accession AL768169 [GenBank]
Graphic View Graphic view of gene At2g31900
Predicted Position of Insertion Chr2:13562477 - go to primer design
BLAST e Value 1e-124
Hit Clone Code (BAC ID) F20M17
Hit Gene Code At2g31900 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myosin-like protein XIF
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23