SimpleSearch - Line and FST details


Line specific information

 
Line ID 071E10
Vector Used pAC161
Line Availability only available from NASC (N406778)
Segregation Analysis 50:45:41
Confirmed for Hit At1g34000
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g34000

 
Sequence (A. th genome BLAST matches underlined)
>77-011734-strizhov-E10-oriL
NTGATCCATGTAGCATTTCCCGGACATGCAAGCCTTTACAATTGAATATATCCTGACATG
AAAATTGCATCAGCAATTGGACATGGATTGTATTTAGTCATGGACATGGTTTCAAGGTAG
CTCTGGTATTGAATAAACAAGTTACTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession AL768243 [GenBank]
Graphic View Graphic view of gene At1g34000
Predicted Position of Insertion Chr1:12358457 - go to primer design
BLAST e Value 2e-09
Hit Clone Code (BAC ID) F12G12
Hit Gene Code At1g34000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation one-helix protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40