SimpleSearch - Line and FST details


Line specific information

 
Line ID 071F07
Vector Used pAC161
Line Availability only available from NASC (N406787)
Segregation Analysis 100:64:48
Confirmed for Hit At4g26890
Parent of DUPLO pair 2682
Parent of pair(s) 1642

Gene hit At4g26890

 
Sequence (A. th genome BLAST matches underlined)
>01-K118836-0022-071-F07C-8409
GGTAATTTTCATTAGAGTAGAAATTATTAATGATGTCGTCAGAGGAATATTCCGAGAACA
AGCTGTCTTGATTCGAAATCCAATCTTCAACTTCTTCAATCGTTTGCGACGATGACGTTG
CTTCAACGCAAATCACGTCTTCGTCGCCGTCGCGTTTCTCGGTTTCTTTATGTTTCTCGC
CTCTCACTTGAATCCATCCGCCATCGTCTTCCGTATCCCAATCAAGTAAGCTTGAAAACT
CATCTCCGGCGAGTTTCTCGATCCGATCAGCCGGTGAATCCAAAGATTCCGAGTATTCAG
CAAAAGGGTCTTCATGATCAATCGAAACTAAGTGACTTTTGGAGCTTTCGCATGAATCCC
AAAATCGTTGATCCAACACAGTGCTTGGAGAAGAAGTCTTGTTCTTCAAACAATCACTTG
TCTGAGATTCTTCGTCGTCATCAAGAAATGGATGTTTAAGTAATTCTTCCACAGTCCATC
TCTGTTTTGAATCTTCCT
GenBank Accession HG968695 [GenBank]
Graphic View Graphic view of gene At4g26890
Predicted Position of Insertion Chr4:13513263 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F10M23
Hit Gene Code At4g26890 [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase kinase kinase 16
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23