SimpleSearch - Line and FST details


Line specific information

 
Line ID 071F07
Vector Used pAC161
Line Availability only available from NASC (N406787)
Segregation Analysis 100:64:48
Confirmed for Hit At4g26890
Parent of DUPLO pair 2682
Parent of pair(s) 1642

Gene hit At4g26890

 
Sequence (A. th genome BLAST matches underlined)
>54-011734-strizhov-F7-oriL
NTGATCCATGTAGAATTTCCCGGACAGTGAAGCCTTGACAATAGGACATCTACTTTAATG
ATGGCTACAGCGAAAAATATAGAAGAGCTCGTTACTAATCTTAAGAATTACATATTACAC
CTAATTCAGTAACTTTAGACGATGCAAGGGCAGTAACTATGGGATCCTCCCTATAAAGAG
TCGGTATATAGCTGATCAAACTTCAAAATAAAAGAATCTATGTACATTAGTACATTACCT
AAATATTTCCAATGCAACATATGCGTTAGGTTATGTGCTAACGATCACTATTGTATGGAC
TCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACNNNACGGCGAGTNCTGTTAGGT
CCTTTATTTGAATCTTTGACTCCATGGAAATTGGGGATCCTCTATGGGATCCTCCCTATA
GGGAGCCCGATTACTAAACTTGGTTGGGAAGGCCAAAAAGCGCTGCCAGCTTTGGTGAGC
AGGGATGTAGAATTCCGAACGTATATAAACACAAGCCGGTATTATACATGGGTCACCAAG
ATATGGTTTTTTAGAATGGGTGCGGGAAGATAAAGCGAGGAGGCGATTTTTTTGACAATG
TAATTTAGGTCAAGTTTCAACAAGTTCTTTAGGGAGAAGATGTAGGAAGTAGAAGAAAAA
GTGGAAGCCCCGCAAAGTGCAGACTGGTCTTGTAGACAACACATATTACAGGCAAGGCTA
CGAGGGATAAACCGCACGACAGTCAGACGAAAGAAAACACAAAAGACAGTGATTGTGTAG
TTGAAAAAGGAGGGAGACCACGGGGTGATATTAAATAGATACGAATGAATAGTAAGCCAG
GTTGCTATAGTGCAAAGAAATAGATTAATTTTATTTCTTAAACGTAAGGTCCGAAGAGCC
TCAATTGCACGTAAGAGCGACTAGCATCTGTATAAACTACAACCGACGAAGGAAAATGCT
AAAACACCAAAGAAAGGAGCACTCACAGACGTGACATATTTATAAAAAATAATAA
GenBank Accession BX942865 [GenBank]
Graphic View Graphic view of gene At4g26890
Predicted Position of Insertion Chr4:13513289 - go to primer design
BLAST e Value 8e-55
Hit Clone Code (BAC ID) F10M23
Hit Gene Code At4g26890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase kinase kinase 16
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX942865 [GenBank]


Last Updated on 31.08.2016 09:40