SimpleSearch - Line and FST details


Line specific information

 
Line ID 074D06
Vector Used pAC161
Line Availability only available from NASC (N407050)
Segregation Analysis 100:93:65
Confirmed for Hit At5g44080
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g44080

 
Sequence (A. th genome BLAST matches underlined)
>44-011892-strizhov-D6-8409
GTGATCCATGGTAGATTTCCCGGACCATGAAGCCTTTACAATTGCTTTATCCAATGGCTC
AACCATCACTCTCGCTCTCTTCCCTCTATGGGATCCTCCCTATAGTGAGTCGTATTACAT
AGGAACTTCCTTATATAGAGGAAGGGTCTTGCGAACGATAATGGGATTGGGCGTCATCCC
TTACGACAGTGGAGATATCACATTCAATCCACTTGCTCTGAAGACCTGGGTGGAACGGAT
TCTTTTTCCACGATGCTCCTGGTGGGTGGGGGCCCATCTGATACAACACGCTGGCCTATA
GGCGTCTTCAACCATGGCCTTTCCTTTATCGCATGGATGTGCGTTCAGAAGAGCCACCTT
ACTTTGACACTATGTTCACAATAGAGCGACAGATAGCTGGACCTTGGAATCCTAGGAGGT
GACCGGATATTACCCTTTGCAGAACAGTCTGAATAGCCCTTTGGTCTTCGGAGACTGCTT
CTCTAATATTTTTCGAGATAACATCCGTGTCAGGCTACACCATGCATACGCAGATCTTTT
TCTTGTATTTGAGTCTAACCATACTCTGTATGATCTG
GenBank Accession BX890737 [GenBank]
Graphic View Graphic view of gene At5g44080
Predicted Position of Insertion Chr5:17739045 - go to primer design
BLAST e Value 3e-17
Hit Clone Code (BAC ID) MRH10
Hit Gene Code At5g44080 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Basic-leucine zipper (bZIP) transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23