SimpleSearch - Line and FST details


Line specific information

 
Line ID 075G01
Vector Used pAC161
Line Availability only available from NASC (N407177)
Segregation Analysis 100:81:66
Confirmed for Hit At1g54970
Parent of DUPLO pair 2329
Parent of pair(s) none

Gene hit At1g54970

 
Sequence (A. th genome BLAST matches underlined)
>07-011890-strizhov-G1-8409
TGATCCATGTAGATTTCTTTTTCTACATTACTCATTGCGGAGCGCGTGGTTAGTGTTTTG
CCTTTTAGCTATGGGATCCTCCCTATAGTGAGTCGTATTACTAATACCGGGATTGCGCGT
CATCCCTTACGTCCGTGGAGATATCCATCAATCCACTTGCTTTGAAGACGTGGATGCAAC
GTCTTCTTTTTCCCCATGCTCCTCGTGGGTGGGGGTCCTTCTTTGGGACCACTGCCGGCA
GAGGCATCTTCAACGATGGCCTTTCCTTTATCGCAATGATGGCATTTGTATGAGCCACCT
TGCTTTCCCACTATCTTCACAATAAAGTGACAGCATATCTGGGCAACTGGAATCCGAGGA
GGCTGTCGGATATTACCCTTTGTTGAAAAGTCTCAATTGCCCTTTGGTCTTCTGAGACTG
TATCTTTGATATTCTTGGAGTAGACAAGCGTGCACTGCTCCACCATGTTGACGAACATGT
TATTCTTGTCATTGAGTCTTAAGAGACTCTGTATGAACTGTTCGCCAGTCTTTACGGCGA
GATCTGACACGTCCTCTATTCGAATCCTCGACTCCATGGGACTCGTGGATCCTCTATGGG
ATGCTTCCTATATAGAGTCCTCCCACCTACAATNGCGACAAAACCAACCTACACTTCACC
CACCAAACCATTCGTTCCAGAAATCATTTAAGCCCGTGGGAGGATTATTTTAATGCAAAA
CCGGTTACCAACCTTACCTTTTTAAGGGTTTTAAAACCTTAATATTT
GenBank Accession AL768523 [GenBank]
Graphic View Graphic view of gene At1g54970
Predicted Position of Insertion Chr1:20505002 - go to primer design
BLAST e Value 4e-13
Hit Clone Code (BAC ID) F14C21
Hit Gene Code At1g54970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation proline-rich protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03