SimpleSearch - Line and FST details


Line specific information

 
Line ID 076B01
Vector Used pAC161
Line Availability only available from NASC (N407213)
Segregation Analysis 100:92:67
Confirmed for Hit K18I23 At3g55120
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g54350 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g05310

 
Sequence (A. th genome BLAST matches underlined)
>02-011920-strizhov-B1-8409
TTGATCCATGTACTATTCCCCGGACATGAAGACCTTTACAATTGAATATATCCTGTCGTA
CCTGGGGGACTCTTATAATATAATGAAATGGACTCAATCGTAAATGGCTTTACTGTTGAA
CAGTTGATGCCAGAAACCCTAATCTACTAATTACTCGTTCACTTTACTTTACCGGCGCCA
TTGGACGAGACCCTGAGTACACTCTTTACAGATCTTGATTTACATGAATGTTTCTTTTTT
TTCTTAATAAAGCCTAACCACAGAGCATTATTGGAAAAAAAACCCTTGAATCTTCTCCCC
CGGCAATAGTATCCTCCTTACACACTCTTTTTTTTTGGCCCCTGGGAAACAAGCGAAAGC
CTTGGGGAAAACAACCCAACTTAAGGTTGGGTTCGGTTTTTTAAAAGGGTGTTAGCAAAA
AACCAACACCTTTGGGGACCCCTTTAAGGGGGGAAACNNCCCTATCTGGTCCAAGCACAA
AGAAAAAAGAGTTTCATCATATATCTGACTTGATGGACTGTTCGGAGTTAGGACCCAACA
TTATCTACTAACCAAGACTTTTCTGCATACTTGGGATTCCTTCTTAAAC
GenBank Accession AL768570 [GenBank]
Graphic View Graphic view of gene At5g05310
Predicted Position of Insertion Chr5:1574677 - go to primer design
BLAST e Value 2e-36
Hit Clone Code (BAC ID) K18I23
Hit Gene Code At5g05310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TLC ATP/ADP transporter
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit AL768568 [GenBank]

Gene hit At3g54350

 
Sequence (A. th genome BLAST matches underlined)
>02-011920-strizhov-B1-8409
TTGATCCATGTACTATTCCCCGGACATGAAGACCTTTACAATTGAATATATCCTGTCGTA
CCTGGGGGACTCTTATAATATAATGAAATGGACTCAATCGTAAATGGCTTTACTGTTGAA
CAGTTGATGCCAGAAACCCTAATCTACTAATTACTCGTTCACTTTACTTTACCGGCGCCA
TTGGACGAGACCCTGAGTACACTCTTTACAGATCTTGATTTACATGAATGTTTCTTTTTT
TTCTTAATAAAGCCTAACCACAGAGCATTATTGGAAAAAAAACCCTTGAATCTTCTCCCC
CGGCAATAGTATCCTCCTTACACACTCTTTTTTTTTGGCCCCTGGGAAACAAGCGAAAGC
CTTGGGGAAAACAACCCAACTTAAGGTTGGGTTCGGTTTTTTAAAAGGGTGTTAGCAAAA
AACCAACACCTTTGGGGACCCCTTTAAGGGGGGAAACNNCCCTATCTGGTCCAAGCACAA
AGAAAAAAGAGTTTCATCATATATCTGACTTGATGGACTGTTCGGAGTTAGGACCCAACA
TTATCTACTAACCAAGACTTTTCTGCATACTTGGGATTCCTTCTTAAAC
GenBank Accession AL768570 [GenBank]
Graphic View Graphic view of gene At3g54350
Predicted Position of Insertion Chr3:20122322 - go to primer design
BLAST e Value 1e-37
Hit Clone Code (BAC ID) T12E18
Hit Gene Code At3g54350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Forkhead-associated (FHA) domain-containing protein
Insertion Classification CDSi
Confirmation Status failed

Gene hit At3g55120

 
Sequence (A. th genome BLAST matches underlined)
>02-011889-strizhov-B1-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGAAGCC
CATTGGGGACTCTTTACTATAATGAAATGGTCTGAATCTTAGATGGGTTTACTGATGACC
AGCGGCTCCCAGATACCTTAATTACCTCGCTTGTCCCTCTCTGTACTCTGCCGGCGCCGA
TGGTAAGATCCTTGTTCACTCTTTCCCGATCGTGCCGTACATGAAGGCACCGGCCTCCTC
CAATCCATTATTCCTCGGCGGCGCCGGTTCGGTAGTTCGCTCTGTACTTCTTTATCTTCT
TCTTTTTCTTCGAGTTGCTGACTACTTTCCGTTTTGCTAACTGACGCAGGCGACCGAGGC
CTGGATATCCAACGTAAATTCGTGATCTTCACCGTCATTGATATCCATGTTAGCTACAAA
ACAACAGTAACTGTGGCCAACTTAGTTGTGAAACAACACTATACTGGTCGAAGCAAAAAG
AAAAAAGAGTTTCATCATATATCTGATTTGATGGACTGTTTGNAGTTANGACCAAACATT
ATCTACGAACCAAGACTTTTCTCCTAACTGGGGATTCCTTCTTAAACCCTATGGCATCCT
CCCTATAGTGAGTCGTTTTACT
GenBank Accession AL768568 [GenBank]
Graphic View Graphic view of gene At3g55120
Predicted Position of Insertion Chr3:20431490 - go to primer design
BLAST e Value 9e-67
Hit Clone Code (BAC ID) T15C9
Hit Gene Code At3g55120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chalcone-flavanone isomerase family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03