SimpleSearch - Line and FST details


Line specific information

 
Line ID 076B01
Vector Used pAC161
Line Availability only available from NASC (N407213)
Segregation Analysis 100:92:67
Confirmed for Hit At3g55120
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g54350

 
Sequence (A. th genome BLAST matches underlined)
>02-011920-strizhov-B1-8409
TTGATCCATGTACTATTCCCCGGACATGAAGACCTTTACAATTGAATATATCCTGTCGTA
CCTGGGGGACTCTTATAATATAATGAAATGGACTCAATCGTAAATGGCTTTACTGTTGAA
CAGTTGATGCCAGAAACCCTAATCTACTAATTACTCGTTCACTTTACTTTACCGGCGCCA
TTGGACGAGACCCTGAGTACACTCTTTACAGATCTTGATTTACATGAATGTTTCTTTTTT
TTCTTAATAAAGCCTAACCACAGAGCATTATTGGAAAAAAAACCCTTGAATCTTCTCCCC
CGGCAATAGTATCCTCCTTACACACTCTTTTTTTTTGGCCCCTGGGAAACAAGCGAAAGC
CTTGGGGAAAACAACCCAACTTAAGGTTGGGTTCGGTTTTTTAAAAGGGTGTTAGCAAAA
AACCAACACCTTTGGGGACCCCTTTAAGGGGGGAAACNNCCCTATCTGGTCCAAGCACAA
AGAAAAAAGAGTTTCATCATATATCTGACTTGATGGACTGTTCGGAGTTAGGACCCAACA
TTATCTACTAACCAAGACTTTTCTGCATACTTGGGATTCCTTCTTAAAC
GenBank Accession AL768570 [GenBank]
Graphic View Graphic view of gene At3g54350
Predicted Position of Insertion Chr3:20122322 - go to primer design
BLAST e Value 1e-37
Hit Clone Code (BAC ID) T12E18
Hit Gene Code At3g54350 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Forkhead-associated (FHA) domain-containing protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g55120

 
Sequence (A. th genome BLAST matches underlined)
>02-011889-strizhov-B1-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGAAGCC
CATTGGGGACTCTTTACTATAATGAAATGGTCTGAATCTTAGATGGGTTTACTGATGACC
AGCGGCTCCCAGATACCTTAATTACCTCGCTTGTCCCTCTCTGTACTCTGCCGGCGCCGA
TGGTAAGATCCTTGTTCACTCTTTCCCGATCGTGCCGTACATGAAGGCACCGGCCTCCTC
CAATCCATTATTCCTCGGCGGCGCCGGTTCGGTAGTTCGCTCTGTACTTCTTTATCTTCT
TCTTTTTCTTCGAGTTGCTGACTACTTTCCGTTTTGCTAACTGACGCAGGCGACCGAGGC
CTGGATATCCAACGTAAATTCGTGATCTTCACCGTCATTGATATCCATGTTAGCTACAAA
ACAACAGTAACTGTGGCCAACTTAGTTGTGAAACAACACTATACTGGTCGAAGCAAAAAG
AAAAAAGAGTTTCATCATATATCTGATTTGATGGACTGTTTGNAGTTANGACCAAACATT
ATCTACGAACCAAGACTTTTCTCCTAACTGGGGATTCCTTCTTAAACCCTATGGCATCCT
CCCTATAGTGAGTCGTTTTACT
GenBank Accession AL768568 [GenBank]
Graphic View Graphic view of gene At3g55120
Predicted Position of Insertion Chr3:20431490 - go to primer design
BLAST e Value 9e-67
Hit Clone Code (BAC ID) T15C9
Hit Gene Code At3g55120 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chalcone-flavanone isomerase family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23