SimpleSearch - Line and FST details


Line specific information

 
Line ID 078D02
Vector Used pAC161
Line Availability only available from NASC (N407430)
Segregation Analysis 50:21:17
Confirmed for Hit At5g62680
Parent of DUPLO pair none
Parent of pair(s) 4405, 7304, 79180

Gene hit At1g33520

 
Sequence (A. th genome BLAST matches underlined)
>12-K016174-022-078-D02-8409
ATTCCAAGCTCGTGTTGTTTCAATGCATGAGTCCTACCCATCTTTGCTACAAGTTCACAT
GCATAGGACATCAATTACAACGAATCATACATGGAGATAACCAGACTTCTCCGAAGCTCT
CCCCAACATGAATATGCGAGAACATTATGACGGAGGCACATAAAAGAGAACCGTGAAATG
CAATGCTTGATATAGATTAAAAGCTCGCAGTATAACACGTACGAAACTCCATAAACACCT
CGTCAATCTCAAAGATGCAAGAAAACTAAACAAGGAAATGAGCTATGGGATCCTCCTTAA
TAGTGAGATGANAACNGCNAANCGTTTANGGATTCNAACCGTTGCGGTTTACAGTGACGC
TGATAGAGATTCGCTCCATGTGAAATCTGCAGACGAAGCGGTACGGATTGGCCCGCCCTC
GGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL937304 [GenBank]
Graphic View Graphic view of gene At1g33520
Predicted Position of Insertion Chr1:12157157 - go to primer design
BLAST e Value 7e-64
Hit Clone Code (BAC ID) F10C21
Hit Gene Code At1g33520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation D111/G-patch domain-containing protein
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At5g62680

 
Sequence (A. th genome BLAST matches underlined)
>12-K016176-022-078-D02-8409
TGTCATGANATTTCCCGGACATGAAGCCATTTACAATTGATCATAGCATACTGCGACTAT
TGAATGGAGTTTGATGAGCAAACGCTCACAGATGAGGCTGTCTCCCGCGATGTAATTCTC
GTCTCTGGATCCTGACCAGTTATGAGTTTGGACATGACGGAACATAGGGACTGACCCGAA
GCTCTGATCTTTATGGCATACTCATCTATCGCGAGAGAAAATCAAGCAGGCCAAAAACAT
TAGAACGGCAGGGATGGTTAGACCGATCGTCCAACTGACATTAGACTGAACGTAGACGAC
TATGGGATCCTCCCTATAGTGAG
GenBank Accession AL937305 [GenBank]
Graphic View Graphic view of gene At5g62680
Predicted Position of Insertion Chr5:25166453 - go to primer design
BLAST e Value 9e-42
Hit Clone Code (BAC ID) MRG21
Hit Gene Code At5g62680 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23