SimpleSearch - Line and FST details


Line specific information

 
Line ID 078G11
Vector Used pAC161
Line Availability available as T3 set from NASC (N407475)
Segregation Analysis 200:24:16
Confirmed for Hit At4g37490
Parent of DUPLO pair none
Parent of pair(s) 2975, 3007, 96641

Gene hit At4g37490

 
Sequence (A. th genome BLAST matches underlined) 
>87-K016174-022-078-G11-8409
CATATGATGAAATGTATAACCCATGGAGAACCTAAAAAAACGCTCTCTTACCTTTTCGTC
TGCAATGGAAGCTTTGNATGAACGAGCTATGGGATCTCCCCTATAGTGAG
GenBank Accession CR356264 [GenBank]
Graphic View Graphic view of gene At4g37490
Predicted Position of Insertion Chr4:17622607 - go to primer design
BLAST e Value 3e-11
Hit Clone Code (BAC ID) F6G17
Hit Gene Code At4g37490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CYCLIN B1;1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR356264 [GenBank]


Last Updated on 10.06.2021 13:37