SimpleSearch - Line and FST details


Line specific information

 
Line ID 078H06
Vector Used pAC161
Line Availability only available from NASC (N407482)
Segregation Analysis 50:10:3
Confirmed for Hit At1g49340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g49340

 
Sequence (A. th genome BLAST matches underlined)
>48-K016174-022-078-H06-8409
TTTCCCGGACTGAAGCCTTCACAATTGAATACTCATTTACAACGGACTGAATTATCAACC
CGAGAGCGGAGAAGAAAAGAGAGAGAAAAAAAGAAAGGGAAGGGACAAAAAAATAAATGG
TGACTCAGGCGACCCACAAGCCCTTCCATGGCTGCTTCTTCTTCTTCCTCTCACCCAGAG
ACACGAATTGAAGAAATTTGAATTCTACCACCAATTTTCTACACTCACATTTATGATTTT
CCCGTTCTTGTTGGATCCTACGAGATTTTGACTCGATCTTCAGAGGCAGATCTGATCGCG
AAAATTTCTTATTTCCAGCTAATTTTCCCGCAACGTTGTTTTTTTTGTTTAATCGGAGAT
GGAGGCACTGACGGAGCTTTGTGACATTATAGCAAAGAATCCGAAGCAATTCTCGGAGAA
GTTAGCTTGAATATGCGGTCGTTGTCCACAAACGGAATGGCTTCTCGCTGAATCGCCCAG
GGTTTCTCGGAGACATCTCAACGCTGTTTTAGCCGATGCTCGGATCATCTCCAAGAATCC
AGAATCAATCGATAATCTGCCAAAAATCCGACGATTAATGAGTTTCTCAGCGCTATACCT
GCATCGTTCCGCCGTTCCTTCTGGCCGCATTCTTTTCCCTTCGCAGCTGATCTCTTCGTT
TTATTGTGATTTCTTGAGTTATCTTTCGTGTGCGGCGGATCTATCCCCGGAATTTGGTAC
A
GenBank Accession AL937380 [GenBank]
Graphic View Graphic view of gene At1g49340
Predicted Position of Insertion Chr1:18252045 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F13F21
Hit Gene Code At1g49340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphatidylinositol 3- and 4-kinase family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences

Gene hit At4g29680

 
Sequence (A. th genome BLAST matches underlined)
>48-K016176-022-078-H06-8409
TGATCTGAAATTTCCCGGAATGAAGCCATTTACATTGATCATTTGCTGATACATGTAGAT
TTTGCAGAACAGTAACTTGCTAAGATCATTAGTTCTCGATCACAAGCTACTGCATGTGTT
TCCTATGGGATCCTCCGTATAGTGAGAGACACATTATCAGCTAAAAAACCTAAATCAGTT
CCACAAGAAGAAGACCAAGACCCACCAAGCCAATCAATCGCACTTCTCGACAATCACACA
GATTCCTCCGGTTCTGATTCTTCCACTATGGGATCCTCCCTATAGTGAGAGANNGNCGAA
NNNCNGGNNNATGGNNTCCGAGGAGGCCGCACGGAAATAAGCCTACGATGAAAAGTGACT
GTTGCCCAATGGACTTGAGAGACCGGATCTGTGATATTTTAGGAGTAAACAAGCGTGTGA
TGCTCCACCATGTTGAGAAAGAGTCTCTTCGGGGCATAGAGCCAAGAGAGACTCTGAAGG
AACTGGTGGCCGGTATTTAGGGCGAGCTCTGGGAGGTCCACTAGGTGAATATTATGACTC
TATGGGATTGGCGAT
GenBank Accession AL937381 [GenBank]
Graphic View Graphic view of gene At4g29680
Predicted Position of Insertion Chr4:14539634 - go to primer design
BLAST e Value 4e-62
Hit Clone Code (BAC ID) T16L4
Hit Gene Code At4g29680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Alkaline-phosphatase-like family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 31.08.2016 09:40