SimpleSearch - Line and FST details


Line specific information

 
Line ID 079D09
Vector Used pAC161
Line Availability only available from NASC (N407533)
Segregation Analysis 100:75:59
Confirmed for Hit At2g44090
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F21A14

 
Sequence (A. th genome BLAST matches underlined)
>68-011917-strizhov-D9-8409
NCTTGATCCATGTAGATCTTCCCGTACATGAANGCCTTTACAATTGAAGTGATTTAGGGG
AGGGTCGAATCTTAGCGACAAAGGGCTGAATCTCAGTGGATCGTGGCAGCAAGGCCACTC
TGCCACTTACAATACCCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCT
CGGTGGTAATTATAATTCAAGGCGGTCCGAACGACGCTTCCGCCGAACGGACTTAGCCAA
CGACACGTGCCTTTGGGAGCCTAAGCTCCTATGGGATCCTCCT
GenBank Accession AL768841 [GenBank]
Graphic View Graphic view of sequence AL768841 of line 079D09
Predicted Position of Insertion Chr3:14193099 - go to primer design
BLAST e Value 2e-123
Hit Clone Code (BAC ID) F21A14
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g44090

 
Sequence (A. th genome BLAST matches underlined)
>68-011888-strizhov-D9-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGGGCGG
ACATGAGAACCTCCATATAGTGATGTACGAATTACTGCAGATTGTAAAAGGGCGAGAAAA
GGTTTATCTCGTCCTACCATGTGAATGTAGCATGCCAACACACAGGGTAGACCCTCCGTA
GCGCTAGGCATGTCCGTGCAATAATGACGTATAGCTAACCACCCAAACGTCGGAAGGACT
GACGACATGAGCAGCATTCCAAAAAAATCCCTTGTCTCGTATGAGTCGGCTATGGGAACC
TCCCTATAGAGAGACAAACTACTTAAAAGGAGGAGGAGGCAATGGTGGAAGAATCAACGG
TAAGATCAAGAGAGATGCTGTGAGACCAACAAGCACAACCATTGATTCTAAACTGAAGTA
ACTCGCTGATATTAGCCTCCTTGGACTGTTCTGCGACGACAATGTCCGAAACAATTCTTG
CTTCCCCATAATCCGGAGCTGGAGCTAAACCACGAAAA
GenBank Accession AL768840 [GenBank]
Graphic View Graphic view of gene At2g44090
Predicted Position of Insertion Chr2:18238294 - go to primer design
BLAST e Value 5e-99
Hit Clone Code (BAC ID) F6E13
Hit Gene Code At2g44090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ankyrin repeat family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences


Last Updated on 31.08.2016 09:40