SimpleSearch - Line and FST details


Line specific information

 
Line ID 079E01
Vector Used pAC161
Line Availability only available from NASC (N407537)
Segregation Analysis 78:76:71
Confirmed for Hit At1g62180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g62180

 
Sequence (A. th genome BLAST matches underlined)
>05-011888-strizhov-E1-8409
CTGATCCATGTAGATTTCCCGGACATGAAGACCTTTACAATTGATCACTATGCAGATTTT
CGATACTATTGCTGTACATCACTTCGATTTTGGGATATTGCGAGTACTGCATGCGCCTTA
ACAACATCTATTTACTACTCGATAGACTCGACCATCCCTCTGCTATAGAAGGCGCAAAAC
AACCCGTGGAGTTCTTTCCTAAGGGACACGTCGAGACTGTGATACTCCCTAGATGAAGCC
TTGTGCATACCCCATACCTTGAGCGGAACGACAGATCGGAATTTCGCCACTTTAACTCCT
TTCCCCGCAAGTGTCTCAGCCAATTCGATGTACGATGCTTCCATCGCCTGGCAGAAAGGG
CACCATGGAGCGTAAAGTACGACCAACCACGCCTCTTTACGGTTCTCTATGGGATCCTCC
CTATAGTGAGTCGTATATACTGANAGAGGCATTGGCAGCTCAGCATCACGCAGAGAAGAG
TTCTGAGATTGAAAAATTCAGAGCGGGTGAACTATGGGATCCTCCCTA
GenBank Accession AL768851 [GenBank]
Graphic View Graphic view of gene At1g62180
Predicted Position of Insertion Chr1:22975736 - go to primer design
BLAST e Value 1e-62
Hit Clone Code (BAC ID) F19K23
Hit Gene Code At1g62180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 5'adenylylphosphosulfate reductase 2
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit AL768851 [GenBank]


Last Updated on 31.08.2016 09:40