SimpleSearch - Line and FST details


Line specific information

 
Line ID 079F11
Vector Used pAC161
Line Availability only available from NASC (N407559)
Segregation Analysis 40:14:7
Confirmed for Hit At1g15240
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F11P17

 
Sequence (A. th genome BLAST matches underlined)
>86-011888-strizhov-F11-8409
TGATCCATGTAGATTTCCAGGACATGACCGTCGTCTACCACTGGGATGGCTATGGGATCC
TGACTATAATGAGTTATATGAGCTATACATACTACTATTCGAGTCTTTGACTGTTTCTAT
TAAAAACAAAGAAAGGAAATGATAACGTTATTATTAAAGTAATTAACTTGAACATACGAC
AATTATTCAGTAGATAGAATAACTTAACAACTAAATATCCTTAACGTGTGTTTCGTAAGT
CAAATACGCGTACGAGGTAGTTAATCAGTTCTTTAATTACTACTTTGCCCAAAAGTAACC
CTTTTTATTGTAATTTGGTCGGTTTCAATTTCAATATGTAAAGAACGATCATAGTTTAAA
TGAATAGGGTTTGTG
GenBank Accession AL768893 [GenBank]
Graphic View Graphic view of sequence AL768893 of line 079F11
Predicted Position of Insertion Chr1:22598788 - go to primer design
BLAST e Value 3e-156
Hit Clone Code (BAC ID) F11P17
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g15240

 
Sequence (A. th genome BLAST matches underlined)
>86-011917-strizhov-F11-8409
NTGATCCATGTAGCATTTCCCGGACATGAAGTCCTTTACAATTGAATATTTCCTGTAATT
CTATTATATATGGATAATAACAACACTCAACTTACGGGACATGAGGTACGAAAGTCCGAC
GACACATATGACCTCGATTACGATTCGTTACTTGGCTTCATCTACCAGGTCCGGAATAGT
CACCACTTGCTTCTGGGCGCTCATAGGTGAATCCGTCTTTTCTGATCTCACACACGCTTG
CTTAATCCGTCCTTCAGTGAAATTACCAGACAGAGCGGACGGATTTCTTCCAGAACTTAA
GGACCCATTCCCGGGGAATCAGGACCCGATCTTCGAAAAACGTCCGGATCAGGAAAGATG
AGCTGGTTTAGAAACACTGAAAAGGGAAGAGAGGGAGAGAGAATCACTGGCTGGGTAGCC
AAATACGGGATACGAATTGATAGAATCGGCGGTAATGGATTCTTTCCCGGGGAAGGTGGT
CGATTCCACACGTGTCTACGGCGAATGATGCCGGGAATACAGTATGAGGATCTTTTAATT
CTCTCTCTTCGATGGAGCTACAGTCAAGTAATGGTTTATTTATATTAACAAAACCCTGGG
CAATCACTGAAGTGCATATGATCTC
GenBank Accession AL768894 [GenBank]
Graphic View Graphic view of gene At1g15240
Predicted Position of Insertion Chr1:5243944 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F9L1
Hit Gene Code At1g15240 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phox-associated domain;Phox-like;Sorting nexin, C-terminal
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23