SimpleSearch - Line and FST details


Line specific information

 
Line ID 079H07
Vector Used pAC161
Line Availability only available from NASC (N407579)
Segregation Analysis 100:54:43
Confirmed for Hit At2g40950
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g40950

 
Sequence (A. th genome BLAST matches underlined)
>56-011917-strizhov-H7-8409
TTGATCCATGGTAGATTTCCCGGACATGAAGCTCTGTACATGAACTCATTCCTCCATAAC
CCCTTTCTTCCTTTTGAATCTCTCCTTCTTCTTCTTCATCCCCAAATTCGAAACCCTAAC
CCTAAAACTCAGTTTCAAAATGGCTGAACCAATCACCAAGGAGCAGCCTCCTCCACCTGC
TCCGGACCCTAATTCCACCTACCCTCCTCCGTCCGATTTTGATTCCATCTCGATCCCTCC
GTTAGATGATCATTTCTCCGATCAGACTCCGATTGGTGAACTAATGTCCGATCTGGGGTT
TCCCGATGGTGAATTCGAGCTCACTTTCGACGGTATGGACGATCTTTACTTCCCTGCTGA
GAATGAGTCGTTTCTCATCCCTATCAATACGTCCAATCAAGAACAGTTTGGTGATTTCAC
TCCGGAGTCTGAAAGTTCTGGAATTTCCGGTGATTGTATTGTTCCCAAAGATGCAGATAA
GACTATTACAACTTCCGGTTGATTAACCGGGAATTCCTTATGGG
GenBank Accession AL768939 [GenBank]
Graphic View Graphic view of gene At2g40950
Predicted Position of Insertion Chr2:17090421 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T20B5
Hit Gene Code At2g40950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Basic-leucine zipper (bZIP) transcription factor family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL768939 [GenBank]

Gene hit At2g09220

 
Sequence (A. th genome BLAST matches underlined)
>56-011918-strizhov-H7-8409
TGCAGAACATGTGGCATGTTGAGGTCATATGGAAACAGGTCACAAGACTCAAATTCTTTA
CATTGCGGCGGGTAGACGCTAGCTTTCTATGGGATCCTCCTTATAGTGAAGGAAAGGACT
TGCGAAGGATTGTGGGATTGTGCGTCATCCCTTACGACCGAGGAGATCTTGCATCAATCC
ACTTGCTTTGAAGACGAGGGAGGAACGCCTTCTTTTTCCACGATGCTCCTTGTGGGTGGG
GGGCACTCTGTGTGACCACAGTGAGCAGAAGCTTCTTATACGATGGACTTTCCTTTATCG
CAATGATGGCATTGGGAGGAACCACCTTCCTTTTCGCCTATCTTCACAATATAGTGACAG
ATATCTGGACGATGGAATACGACGAGGTTTTCGAATATTACCCTTTGGTGAAGAGTCTCA
ATTGCCCTTTGGACTGCTGAGACTGCATCTTTGATATTTGGAGGAGTACACAATGCGCGT
GGCGCTCCACCGTGTGAGACGAACATTTTCTTCTTGTCCTTGACTCTTAAGAGACTCTGT
ATGAACTGTTCGCCAGCCTTTACGGCGAGTTCTATTACGCCTCTCTATGTGAATCTTTGA
CTCCATGGGAATTGGGGATACTGTATGGGATACTCCTAGAGGGGAAAACGCCCGGGGCCA
CCTCCACCTGGTGGAAGAAAACCTTTTGGTTGGT
GenBank Accession AL768940 [GenBank]
Graphic View Graphic view of gene At2g09220
Predicted Position of Insertion Chr2:17137232 - go to primer design
BLAST e Value 5e-25
Hit Clone Code (BAC ID) T3K9
Hit Gene Code At2g09220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation long noncoding RNA
Insertion Classification TS2TE
Confirmation Status unknown


Last Updated on 31.08.2016 09:40