SimpleSearch - Line and FST details


Line specific information

 
Line ID 080A02
Vector Used pAC161
Line Availability only available from NASC (N407586)
Segregation Analysis 100:98:88
Confirmed for Hit F14G24
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At2g46020 can not be ordered because the confirmation of this insertion failed.

Gene hit F14G24

 
Sequence (A. th genome BLAST matches underlined)
>09-K016175-022-080-A02-8409
ATATCGATAGAGCCGGAGTGCATTCTCTGCGCAAGAGATTACACTGTATCTGACTGCGAC
TATACATAATGAATTACGTCTACTTGCATAAAATGAATAGATAATGAAAACTCGATGCTA
TCACACCCTATGAAGAGAAAGCCCTTGAGAAACAAAACCCAAATAACGAGCTATGGGATC
CTCCCTATAGTGAG
GenBank Accession AL937391 [GenBank]
Graphic View Graphic view of sequence AL937391 of line 080A02
Predicted Position of Insertion Chr1:19713563 - go to primer design
BLAST e Value 4e-13
Hit Clone Code (BAC ID) F14G24
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g46020

 
Sequence (A. th genome BLAST matches underlined)
>09-K016177-022-080-A02-8409
GCAGCGGTGGCCAAACCAACCCACGTCANTCCAACAACANGCGGTGCGGCCAGGTGATTC
TGTGGGATGGGCAAACTCCGGTGAAGAAGGTTAAGGACAGAATTCTGGTAAAAGACGGCC
NANTGGGAATCCTCCTANTAGTGAGANNCNCCNNCCCNCNNCCCCTCCNNCTCTTTCTTT
TCTCTTTCAAAACTTCAATCGCCCCCTCACCAGATATCAAAATCCCCCCCCACACAAAAT
CTCACGCATTTAATATATATAGAACACNGCCATATATAATCTTGAATATTCGCTACCCCC
AATGCAATCATACCTCACATCCACGATGCGCGGCTCCCCGCTTCCACTCACCTCAACACC
ATTTATAACGCCAAAACACCAATCCAACTATTAGCGCCCGATATCCCTTGAAAACCCGTT
CACCGAGGCATTCTTGCGTTGGCGTCCACTACAAACGGAGACGCAAATCCATATATCTCA
CCAAAGTCCCCAAAATAACA
GenBank Accession CT026085 [GenBank]
Graphic View Graphic view of gene At2g46020
Predicted Position of Insertion Chr2:18931450 - go to primer design
BLAST e Value 3e-26
Hit Clone Code (BAC ID) T3F17
Hit Gene Code At2g46020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transcription regulatory protein SNF2
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 517G02


Last Updated on 07.07.2016 14:03