SimpleSearch - Line and FST details


Line specific information

 
Line ID 080B09
Vector Used pAC161
Line Availability only available from NASC (N407605)
Segregation Analysis 100:90:59
Confirmed for Hit At1g43700
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g43700

 
Sequence (A. th genome BLAST matches underlined)
>66-K016177-022-080-B09-8409
TGAGGACTTTGGTTATCNTCTTGAGAACGACCCAANGAAAAAGAAAATGGCCTTTCCCCT
CCCTAAGTCAGCNTTGTTGACTCTAAGCTTGAAGCCGCANTTTTGAGGTGTTACTTTTCA
GTGTTCAGCCTCTGATGTTCCTCTCGACACAANANTAAGAAAAACGCACATGACTTAGAG
ATGCAAGAGACACTGAATACTTTANTCCTACNTCCNANTGTTGCNTTTACTCACCTAAAG
TGGAAACAAAANCTTACACTCTTGCAAGNTGTNTACNTTACACNANTTGACACANTCTCA
CANTGGTTGATTAAGTCAGCTAAATTAACCTGAGAAATACANTNTCTTATAACACNTGCN
TCTATACNTTGTTCCTATGGATCCCCCCCAAAAAGGGAAGAAANNTGGAAANNGAACCCC
CANTAACCATCCTNTCNTAANTCTCCCAAAGACGAGCAAACCAANTCCANNACAACCAAC
TTTAAAAAGGGCCTTGAAGTGTCACCCATTGTTACCTTTCAAATAAACCGGATCTCAAGA
AATATTAAATCGAAAAAATGTTGTAACTGACCAAGCGCACCATA
GenBank Accession BX890741 [GenBank]
Graphic View Graphic view of gene At1g43700
Predicted Position of Insertion Chr1:16485855 - go to primer design
BLAST e Value 3e-35
Hit Clone Code (BAC ID) F2J6
Hit Gene Code At1g43700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation VIRE2-interacting protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g43710

 
Sequence (A. th genome BLAST matches underlined)
>66-K016175-022-080-B09-8409
TGTCCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATANTCCTGGCGGGTAA
ACCTAAGAGAAAAGAGCGTTTATTAGAATAATCGGATATTTAAAAGGGCGTGAAAAGGTT
TATCCGTTCGTCCATTTGTATGTGCATGCCAACCACAGGGTTCCCCTCGGGAGTGCTTGG
CATTCCGTGCGATAATGACTTCTGTTCAACCACCCAAACGTCGGAAAGCCTGACGACGGA
GCAGCATTCCAAAAAGATCCCTTGGCTCGTCTGGGTCGGCTATGGGATCCTCCCTTATAG
TGAGANNNNNNNNNNNNNNNNNNNNNNCNCTTNNNTCNCTTTNNACACNCATATTGTCCT
TCTTTTTTACACATACCATATCCCATCCNNNATACATCTCCCTCCTACAATCACACATCT
TATCTATACACACATTTTTTTTCATCTTTTCNAATGAATCAAAACATCNCATAATTTTCA
ACACTCCTACCCTACTAAAATCCCATAAAAGTTCCCTTTCACTACCACAAATTCCAAATG
TAACCCCCCATAATCATCTTCTCTCAATCTCCCAAAAAACAATCTAACCCATTCCACACC
ACAAACTTTAAAAAGCCTTTGATTCGAACACCTGAGGTACTTTCAATTAAAAGGGTCTCC
CAAGATTATTAATCCTAAAAATAGTGGTAAACTGGCCCAGCGGCACCATAGTCCGAAATC
CAGTTTTTAAGGGAAACCCTTACCCAGATTCCGATTCCGGAGTCCGATTCCCAATCGCAA
AAAAAAGACCGGCCGCGATCAAACTTTTACCAAAAGGGGTTTTGGTTCGTTCAACCCAAA
TTTTCCG
GenBank Accession FR802351 [GenBank]
Graphic View Graphic view of gene At1g43710
Predicted Position of Insertion Chr1:16487561 - go to primer design
BLAST e Value 0.001
Hit Clone Code (BAC ID) F2J6
Hit Gene Code At1g43710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pyridoxal phosphate (PLP)-dependent transferases superfamily protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03