SimpleSearch - Line and FST details


Line specific information

 
Line ID 080D06
Vector Used pAC161
Line Availability only available from NASC (N407626)
Segregation Analysis 50:46:34
Confirmed for Hit At3g07340
Parent of DUPLO pair 2595
Parent of pair(s) none

Gene hit F10A2

 
Sequence (A. th genome BLAST matches underlined)
>44-K016175-022-080-D06-8409
TGTCCTGTAGATTTCCCGGACTGAAGCCATTTTTCTCTTCTTCTTGATAAGCAGACTCAG
CGTTTGCGTTCATAGCCGTGAAACGTTTGCTTGCGATACTAGGGACGCAGTATCAGCTAC
ACTGAGATTCTGCCATCTTTCGTTTCCTATACCGGACAGAGTCAGATATTTGATCGGACG
GTTGACATTGGTCGATAAAGTGAGCTTGTGAAGTAACACTGCGGCGGCTATACCACGTCT
ATGGGATCCTCGCCTATTTTGTGATAACGGGTTAGGGCCTTGCATCATCTTCATTGATTA
TATGAAGCGAAATCTTAATCCTCATTATAAAGCTTCCTTTGGAAAACCCATTGTCATTAA
AGCAAAGGCAGGGGAAGATAGCACTCGTGACTCCTTTATCCTTCTGGTTGAGGTCCTCGA
GCTTAAATCATAGCAAAGAGGTAGTGATTTGGCTCAAGTCATTTGGACTGTCCCGAATGT
GGTGAACCATCCCGCCAATGGCATGGCTGAATACCTTATGTCTACAGACAGATCATTGGG
ACGGGCGATGTGACAATAACATCCTCCGCTAGCAGTTTCTCCTCAGTCTACAAGCTCATC
CTCTATTGCGAGCTTATCTCCTTCCTCAGCTGCAAGCTCACGCTGCAGTTCCGGCTCATG
CTCCATATCCTTCATGGTGACCTTGAGCATATCATCCCTCTCCCCTTTAGAGAGGGATTT
GACCTCAAATCCGGTTCATCTGCAATAAAAGGTACCAAGTCAGAAACTTAGAGCTAT
GenBank Accession AL937420 [GenBank]
Graphic View Graphic view of sequence AL937420 of line 080D06
Predicted Position of Insertion Chr4:4459976 - go to primer design
BLAST e Value 7e-104
Hit Clone Code (BAC ID) F10A2
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g07340

 
Sequence (A. th genome BLAST matches underlined)
>44-K016177-022-080-D06-8409
TCACTTTTAAAACAACNACACGACTTCGAATAATTTTTGTTTCTAACTTTAANTTTCAAT
ATGGAGCAGTTCTTGTCAATGAAGTTATGTCAGCGAACACCAGGCTGGACTTAACATGGA
CGCTCTCTTGTCTAGGATGTAAGTACCGNCACAACANTTANTAGTAATTTANATTGACAC
TACTTGAANAACAANTTACTTTTTTGTCTTTGCGAACCAAATCGTGTGTTTGTTTAAACT
AATTTCTTTTGTTTTCTGACAGAAACTTTCTTTCAAGCAACAACTCTAATGCACTANTCA
ACAAGATCTCAAATTAGATTCTTCAGCAGAAACGCTTATTGGGTGATCCTCACAACAAAA
TATTTGCAATTGAACACCTGAAATCTTCTTCTANTAACGAAATAAACCCCTTTGGAAA
GenBank Accession AL937421 [GenBank]
Graphic View Graphic view of gene At3g07340
Predicted Position of Insertion Chr3:2342177 - go to primer design
BLAST e Value 2e-92
Hit Clone Code (BAC ID) F21O3
Hit Gene Code At3g07340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40