SimpleSearch - Line and FST details


Line specific information

 
Line ID 080F09
Vector Used pAC161
Line Availability only available from NASC (N407653)
Segregation Analysis 50:49:44
Confirmed for Hit At4g17490
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g17490

 
Sequence (A. th genome BLAST matches underlined)
>70-K016175-022-080-F09-8409
TAGACTATCAGATGAATCGCATATTAAAGTATAGTCTCGAAAGATAGGGGCTGCGTAATT
ATCGGAATCGTAATACTAATTAAGTCCTATGGGATCCCCACTACACTGAGACTTCAATTC
TCTGTTCCCTCCTAATNGTGTACACCGGATCCACNCTCTACTCTGTTCCTCATCAAGAAG
TATCTCCTCGACGAATTGTCTCCGTTGCCTACTACTGCCACCACCAATCGATGGATGAAC
GATTTCACGTCATTTGATCAAACCGGTTTCGAGTTTTCTGAATTTGAAACCAAACCGGAA
ATAATCGATCTCGTCACTCCCAAACCGGAGATTTTTGATTTCGATGTGAAATCTGAAATT
CCATCTGAATCGAACGATTCCTTCACGTTCCAATCGAATCCTCCTCGCGTTACTGTTCAA
TCCAATCGAAAACCGCCGTTGAAGATCGCACCACCGAACCGAACCAAGTGGATTCAATTC
GCAACCGGAAATCCTAAACCGGAACTTCCCGTACCGGTTGTAGCAGCAGAGGAGAAGAGG
CATTACAGAGGAGTGAGGATGAGGCCGTGGGGGGAAATTCGCGGCGGAGATTCGAGACCC
GACTCGTCGTGGAACTCGTGTTTGGCTCGGGACGTTTGAGACGGCGATCGAAGCGGCTTG
GACCCCCCC
GenBank Accession AL937445 [GenBank]
Graphic View Graphic view of gene At4g17490
Predicted Position of Insertion Chr4:9753945 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g17490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ethylene responsive element binding factor 6
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03