SimpleSearch - Line and FST details


Line specific information

 
Line ID 081A06
Vector Used pAC161
Line Availability only available from NASC (N407686)
Segregation Analysis 100:97:70
Confirmed for Hit At5g44530
Parent of DUPLO pair none
Parent of pair(s) 4120, 4184

Gene hit At5g44530

 
Sequence (A. th genome BLAST matches underlined)
>41-K016179-022-081-A06-8409
TGTCCTGTAGATTTCCCGGACATGAAGCCATTTACATTGAATATATTCAATATTCAATTG
ACCATCATACTCTTTGTATAGATTTCGACATTGATCTAAGTCTTATTATTTTACTTACAA
TGCACGAGGAGCGATTCCGCTATGGGATCCGCTCCCTATAGTGAGAGGATATGAGAGATG
TCTCCCGTGTACCGTGAAGTCTTTGCCTCACTTCCAGTTCCCTAGATGCAATAAGATCCT
GCCTATAGTGAGAGCGATTGTGCGTCATCTGTTACGACACGGAAGATATCAGATCTATCC
ACTTGCTTCTTACAGGAGGTTGGTACTACTTCTTTTTCCACGTAGCTCCTCACGGATGGG
GGCCCATCTTTGAGACCACTGTCCGAAGAGGCATCTTCAGCAATGGTCTTTCCTTTATCG
CTATGATGGACTCTGGAGGAGCCACCTTCCTTTTCCAGTATCTTCTCAATATAGTGACAG
ATAGCTGGGCAATGGAATCCAGAGGACGTTTCCTGGATATTACCCTTTGTTGACAAGTCT
CGATTGCCCTTTGGACTTCTGAGACTGTATCTGTGATATTTTTGGAGTATACGAGCGTGT
CGCGCTCCTACCTGTTGACGACGATTATCTTCTAGTGATGGATCCGCAATAGACTCGCTC
GAAAATTGGTACGCCAGTCTTTACGGCGAGTTCTGGTAGGTCCTCTATTTGGATCTTTGA
CTCCAGGGGAATTGGGGATCCTCTA
GenBank Accession BX890742 [GenBank]
Graphic View Graphic view of gene At5g44530
Predicted Position of Insertion Chr5:17939111 - go to primer design
BLAST e Value 3e-29
Hit Clone Code (BAC ID) MFC16
Hit Gene Code At5g44530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Subtilase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g45470

 
Sequence (A. th genome BLAST matches underlined)
>41-K016180-022-081-A06-8409
TGTCATGTAGATTTCCCGGACATGAGCCATTTACAATTGATATATTCAATATTCAATTGA
CCATCATACTCTTTGTATAGATTTCGACATTGATCTAAGTCTTATTATTTTACTTACAAT
GCACGAGGAGCGATTCCACTATGGGATCTCCCCTATAGTGAGANNNNNNANGANNNTTTN
NNGNNNCTTGNNNTNGAGNTCNNNNNGCTCTGGGATGCTCTATTTANNAAGATNGAGATT
TTTNGTGGAGGTATTGGAAGTGTATTGNGGGTATTTGATTATGGTAANGTTGTGGGTGAA
TTCATCATTTTTCATAAGAAACCTAACAAAGGCACAGATTTTCATGGAGCTGATGTCGTA
GTTACTTATACGCTGTTTGCAGTTGGCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX890743 [GenBank]
Graphic View Graphic view of gene At5g45470
Predicted Position of Insertion Chr5:18424040 - go to primer design
BLAST e Value 2e-45
Hit Clone Code (BAC ID) MFC19
Hit Gene Code At5g45470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function (DUF594)
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03