SimpleSearch - Line and FST details


Line specific information

 
Line ID 081C02
Vector Used pAC161
Line Availability only available from NASC (N407706)
Segregation Analysis 50:44:27
Confirmed for Hit At5g57720
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g57720

 
Sequence (A. th genome BLAST matches underlined)
>11-K016180-022-081-C02-8409
AGATTTCACAAGTTTTTCCAGCTCTCTGCAATATATCCGCGTTGATTGCCAATTCAGGTA
TCAGAGCTCTCGCTGCAAATGACGGATCTAAAAATTTGCTTTATGACTTTGACATAAACT
GATTGGAGTGGTACAACACACACTCACGCAGAACCCAATCTCACACTCAAAGACTCTCAC
ATACATTAACTACATTGTTGAAGATTCTACATAACGCTACAGCTTTTTCATTTGTAGAAT
CCTGACTCAAGCAAAGACAAAAAAAGAAGAAGATGGTGTTAGAAAATGGGTTTCCTCCAT
ATCCAGATTTCCTCAAGATCTTCAACTCCCATGAAGATTCTCAACTTTTGGTAAGTAACT
ATGGGATCCTCCCCTAATAGTGAGANNNNNNNNANNNNNGNNNNNNNTNTNTNNANTGNT
NTATGGGAATTTNNNTATANNNGAGAATAANTNNTNNNNAGGNTTNNTNTNNTTTTATGG
GATAGAGAAAGATNAGGGAGATGAATTTATGTTTTAGGATTTGGTGAGTGGTTGAAAAAA
TAANTGTTTGATGTATGTGGGTTTGATTGAAATGAAAAAGGGAGTGATTTTATTTTTGAA
ATTTTGAATTAGTATTT
GenBank Accession AL937502 [GenBank]
Graphic View Graphic view of gene At5g57720
Predicted Position of Insertion Chr5:23391779 - go to primer design
BLAST e Value 6e-151
Hit Clone Code (BAC ID) MRI1
Hit Gene Code At5g57720 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AP2/B3-like transcriptional factor family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL937501 [GenBank]


Last Updated on 14.10.2014 10:23