SimpleSearch - Line and FST details


Line specific information

 
Line ID 081H10
Vector Used pAC161
Line Availability only available from NASC (N407774)
Segregation Analysis 100:99:72
Confirmed for Hit At4g35600
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g35600

 
Sequence (A. th genome BLAST matches underlined)
>80-K016179-022-081-H10-8409
TGATCCTGAAATTTCCCGGACATGAAGCCTTTACATTGAATATATCCTGACTATTGAAAG
AGAACCAACTGAATATATAGTTTAGAACTATTGAAAGAGGCAACGATGGGTTGCAAAATA
ATTTTGACTTAATTTAGATAACAAAATAAAATAAAGGGAGGAAAATTGACTATTGAATAT
ATAGTTTAGAACTATTGAAAGAGGCAACGATGGGTTGCAAAATAATTTTGACTTAATTTA
GATAACAAAATAAAATAAAGGGAGGAAAATTGGGGGTTGCTATGGGA
GenBank Accession CR356266 [GenBank]
Graphic View Graphic view of gene At4g35600
Predicted Position of Insertion Chr4:16896446 - go to primer design
BLAST e Value 2e-49
Hit Clone Code (BAC ID) F8D20
Hit Gene Code At4g35600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T20D16

 
Sequence (A. th genome BLAST matches underlined)
>80-K016180-022-081-H10-8409
GATATATGCTGACTTGAGATCCATATCAGCTATAGAATCCTCCCTATAGTGAGACAATGT
GTTCACCTATGGGATCCTCCCTATAATGAGACCTATAGAGAGAGATGAANCTTATATCAT
ATCTTGGCCGATATCGTTGTACAGTACTCCCTTGTTACACATTAAGCCGACATTATAATG
TGGATTATCTGCTTCCTCCGCATATCAGTTTGCGTCACTCCTTGTCGGCTAACGGGGAGG
CCTCCTCCTCCTACCTCTTTGTGGTCATTGACGTTTCTCCTCTTCTCGCGCTCCATCATA
TTGATGCAGATCTCGATTGCGCGTGGCCTCTAGTTGGTGGTGCGTGAGGGGTTTCTCCTT
TCTGCCGTGGTTGTGGATCTTGATGAAACGTTTGGGTTCGTTGGTCCTCCCATGCGATCC
TCCCTATAGAGAGGCCAAACGCCATCACCATCTCGGAAACCCTCGCGCAATTCTCCCATT
CCGACGCCTGAGACCGAGGGTTAAATCATGCCT
GenBank Accession FR802393 [GenBank]
Graphic View Graphic view of sequence FR802393 of line 081H10
Predicted Position of Insertion Chr2:9923672 - go to primer design
BLAST e Value 3e-54
Hit Clone Code (BAC ID) T20D16
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03