SimpleSearch - Line and FST details


Line specific information

 
Line ID 083C03
Vector Used pAC161
Line Availability only available from NASC (N407899)
Segregation Analysis 50:39:29
Confirmed for Hit At3g05380
Parent of DUPLO pair 12179
Parent of pair(s) none

Gene hit At3g05380

 
Sequence (A. th genome BLAST matches underlined)
>19-011868-strizhov-C3-8409
TTGATCCATGGTAGATTTTCCCGGACATGAAGCCGTTATGAATCTATCTATACTAAGTTT
ACAGGTGGTTTGGTCCTAAACCTATGGGATCCTGCCCTATAGCGAGGACGGTATTCTGAG
CGTTTTTCTCTGAACCATCTTGTGAGTTTAAATCGTTGTTAGCCACAGGCTCTGATCCAT
TTGAAGGAGATGGGTTGTGATGATGCTCTATACTGCCATTTACATGCTCGTGATGTTTGA
CCATAGAGCTGCGTAATAGCTGATTTTTGCCAACCAACTCTAAGGCTTCTTGGATCATTG
TGTTCACATCTTCCCCTTCCTTCACAGATGATGCAGCCTATGGGATCCTCCCTATAGTGA
GTCGTATTACTC
GenBank Accession AL769069 [GenBank]
Graphic View Graphic view of gene At3g05380
Predicted Position of Insertion Chr3:1545717 - go to primer design
BLAST e Value 2e-123
Hit Clone Code (BAC ID) F22F7
Hit Gene Code At3g05380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DIRP ;Myb-like DNA-binding domain
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03