SimpleSearch - Line and FST details


Line specific information

 
Line ID 083E09
Vector Used pAC161
Line Availability only available from NASC (N407929)
Segregation Analysis 100:30:24
Confirmed for Hit At5g55020
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit K6A12

 
Sequence (A. th genome BLAST matches underlined)
>69-011869-strizhov-E9-35St
CTGACGTAAGGGATGACGNCACAATCCACTATCCTTCGCAAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTATCAGTGTGATTTAACTTGATATTGGGAAAAGCACGTAATAACAACTA
AGTTAGGAGAAAAGTAACAAAAAAAAAAAAAATAACCGGGGCCCCCCACGTTAAACACCC
ACTTAAATTCTTTAAAAAAAGGATGCAGGGTTTAAAATGGGGTTGGTTTTAAAAATTGGA
ACCCAAAAATCCTTTTTGTTTAAAAAAAAAAAAGGTTTTCTTTCCCGGGTTTGATTTCAA
CCCAAAAGGGCCGGGAAAAAAAATTTTGTTTGGGAATCCCCCTATAGGGGGGCGGTATTC
ACAGGNNCTTGAAAAAAAAATACAATAGAAAAACATATTATTACCTGAGATTTATTACAT
TGGAAAAGATAT
GenBank Accession AL769099 [GenBank]
Graphic View Graphic view of sequence AL769099 of line 083E09
Predicted Position of Insertion Chr5:20454438 - go to primer design
BLAST e Value 8e-27
Hit Clone Code (BAC ID) K6A12
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g55020

 
Sequence (A. th genome BLAST matches underlined)
>69-011868-strizhov-E9-8409
TTGATCCATGGTAGATTTCCCGGACCATGAAGCCTTTACAATTGACTATTACGTGTACGT
GTACAAATGTACTTCACTGAATCGGATACAGGACGATAATAAACACACTACTCTGTTACT
TTCTCTTCTTGAATAGGCTAGGGATGATGCTATGATCTTGTACGGAGGAGGAGGAGCTGG
GAAAGACGGTGGATCCACCAATCACTTTTCAGACGGAGGAGTGATATTGAAGAAAGGTCC
ATGGACGGCGGCGGAAGATGAGATACTTGCTGCGTACGTTAGAGAGAACGGTGAAGGGAA
TTGGAACGCCGTTCAGAAAAACACAGGTTTGGCTCGTTGCGGCAAAAGCTGCCGTCTTCG
ATGGGCCAATCACCTCCGACCAAATCTGAAAAAAGGCTCTTTCACCGGTGACGAAGAACG
TCTCATCATTCAGCTTCATGCTCAGCTTGGTAACAAATGGGCTCGCATGGCTGCTCAGGT
ATAACAACAACTTATACATATATACTTGGTGTTACCTGCGTTACACGTTAACTAATCTTC
ATGCAATTTATTATAGTTACCGGGAAGAACAGACAACGAGATTTAGAACTATTGGAACAC
GAGATTGAAACCAACTTCTTCGCCAAGGACTTCCTTTTTTTTCCTCCAGATATTATCCCT
AACCCATAACTCCCTCCACAT
GenBank Accession AL769098 [GenBank]
Graphic View Graphic view of gene At5g55020
Predicted Position of Insertion Chr5:22326340 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MBG8
Hit Gene Code At5g55020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 120
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03