SimpleSearch - Line and FST details


Line specific information

 
Line ID 083G09
Vector Used pAC161
Line Availability only available from NASC (N407953)
Segregation Analysis 50:30:27
Confirmed for Hit At3g21380
Parent of DUPLO pair none
Parent of pair(s) 96932, 96933

Gene hit At5g11425

 
Sequence (A. th genome BLAST matches underlined)
>71-011869-strizhov-G9-35St
ACTGAACGTAGGGNATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATA
AGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGC
CTTCGGTTTAAACTATCAGTGTTTGAAAGAAAAAACCCAAAACAAAACTGTAGTCTCGTT
GTAACACCAAAACGGTGGCGCTTGCGCACAGTTGTAGTCTTGTAGATATTAAGCTGAGAA
GTTATTAAAAATGTAAGTGGGCCTTTTCATCATGATCCAATATATTTTTCGCATAAGCCC
AATAGCCCAATATGTGCGATCCACGTCGAGCACAGAGTTTCCTTTTATCACAAAGCAAAG
AGAAGAGAGAGCTTCAGAATCATCACAAACGCTAATCCGTCTCATCCGGATTGGTTCCTC
TCGTCACCTATGGGATCCTCCCTATAGTGAATCGTATTACTCACGNNNCNGCGAAACGGG
GGTGGGCTCCTTTTTCTTTCGCCGGGGCGCCCCGTGTGGGCGGGCCCATATAATAACCTT
GGGGAGGACTCCTATGTCCCAGTAGAAACAATCGGATGAGACGGTTAACGTAAGAGGAAA
TTTCTGAACCTCTCCTCTCTCTGCTTCCGGAAAAACAGAACTTTTGCTGATTTGGTATCA
CATATTGGGCTACTTGGCTTATGCCAAAATATTTGGCTACGTAATAAGAGCCCTTTTATT
TTTAAAACTTTAAAATCTATATTACAAAAACAACTTGTGCGAAGGCCCCCGCTTTGGGTG
TCCAACACACTACCCTTTTTTTTGGGGGTTTTTTTTTACACCGGAAGGCTAAACCAGGGG
GGGAAAAAAATTTTATCCCTAGGACCCTGCTCCTCAAAAAAAGAAACCTCTTTTTAAAAA
AAGGCTCTTCAAACAAACTGGCGACCGGCCCCTCTTCAGTGGAGAAAAAAAAAAACCGGG
ATTTAAACAATGTTTTTGAAATTCTT
GenBank Accession AL769124 [GenBank]
Graphic View Graphic view of gene At5g11425
Predicted Position of Insertion Chr5:3647669 - go to primer design
BLAST e Value 7e-160
Hit Clone Code (BAC ID) F2I11
Hit Gene Code At5g11425 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification 3' region
Confirmation Status unknown

Gene hit At3g21380

 
Sequence (A. th genome BLAST matches underlined)
>71-011868-strizhov-G9-8409
TTGATCCATGGTAGATTTCCCGGACAGTGAAGCATTTACAATTGAATATATACTACATCT
TTCAATTTATGGATGTTGCAATGGGTTTAGTTTGGTCGGTCTCGGTCTTGTGGTCTTGAC
TCTTGACGGGTTGCCTTAGTTTGATTAACTGACACTTAATTACTAAATGAAAAGAAAAAA
TGATGGGTCCTGCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCAANNNNNNNNNNG
NNNNNNNCNNGNNGNGGGCGNNNGCCCGNGGGGCGACCCGCCGGGCCACACGGCCGCACC
ACGCGGGGACCCCCACCGCGGAGGCCACCCGGACCTACCCCCGCAGCGCACCGGGCGACG
TACAAACGCCGGGGAACCTCCCCACCCCGCCACCACCCTCCCCAAGCGCCGCGCCACCGC
GCCGCCGCGACGGGCAAAGAACCCCATCCCCAGCCTACGGGGCCCGGCCGAGAACCCGCC
TGGTCCGAAGTAACACCACGGCCTCCTCGCTGAGGGGGAACTCTTCCACCCTCAGTCTCC
TAAACCCCCCCTAGCGGCGCTGTTTAAAAAAAAAAGACAGCCCCACGCTCACCCCTAACC
GACGGCACGTCACGGCTACTAATACTCGAAGTCCACGGAGGGTCCTTGGTCGGGGGCGTG
GGCCGGCCCGCCCGCCGCCGCTCCCTTGATCCCCACCGGCCCTCAGAACGGGGCGCCGGC
GCACGCGGCCGCACGTGAAAACATCCGAAGACACAATACGAGGAAGAAAGAAAACAAAAG
AAGGAATGG
GenBank Accession AL769123 [GenBank]
Graphic View Graphic view of gene At3g21380
Predicted Position of Insertion Chr3:7528748 - go to primer design
BLAST e Value 3e-79
Hit Clone Code (BAC ID) MHC9
Hit Gene Code At3g21380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mannose-binding lectin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40