SimpleSearch - Line and FST details


Line specific information

 
Line ID 085B06
Vector Used pAC161
Line Availability only available from NASC (N408082)
Segregation Analysis 50:39:22
Confirmed for Hit At4g17490
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g17490

 
Sequence (A. th genome BLAST matches underlined)
>42-011848-strizhov-B6-35St
ATGACGTAAGGGATGACNGCACAATCCCCTATCCTTCGCAAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTATCAGTGTTTGACAGGATATATTGGAGGGTGAACCTAAGAGAAAAGAT
CGTTTATTAGAATAAGGGGATCTTTAATAGGGCGTGAAAGAGGTTTATCCGTTCGTGCAT
TTGTATGTGCATGCCAACCACAGGGTTCCCCTAGGGAGTGCTTGGCATTCCGTGCGATAA
TGACTTCTGTTCAACCACCCAAACGTGGGAAAGCCTGACGACGGATCATCATTCCAAAAA
GATCCCTTGGCTCGTCTGGGTCGGCTAGGAGATCCCGTGAATTCAGAGATTCATGTTTAT
CAAAAGATGAATACGGTGTAGTACTAGGTATAATAAAGATCTCTTGCGTGTCAATATGGG
ACTAATTTACTACTCGTTGCGAGAATACTTCGCATGCATGCATATGCGATATCAAAATGA
AGCGGCCGTATCAACTCAATGTTTGAATAAACACACGTTCTTATATAAAAACTTATGATA
GTTGCAAAACTTGATGGAGGAAAACACTGGTTTTACTTCACGTACAGTCGATGTCATTTT
TGTCTTTGGATAACAATATTTTAGTTTTGAAAACTAG
GenBank Accession FR802483 [GenBank]
Graphic View Graphic view of gene At4g17490
Predicted Position of Insertion Chr4:9754174 - go to primer design
BLAST e Value 1e-71
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g17490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ethylene responsive element binding factor 6
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL769254 [GenBank]


Last Updated on 31.08.2016 09:40