SimpleSearch - Line and FST details


Line specific information

 
Line ID 085D11
Vector Used pAC161
Line Availability only available from NASC (N408111)
Segregation Analysis 50:41:28
Confirmed for Hit At1g30440
Parent of DUPLO pair none
Parent of pair(s) 294, 3151, 3267

Gene hit At1g30440

 
Sequence (A. th genome BLAST matches underlined)
>84-011848-strizhov-D11-35St
CTGACGTAAGGGATGACGCCACAATCCCCTATCCTTCGCAAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTATCAGTGTTTGTGCTCAATTAGAAGCACAAAAGAAAGACCATGGTCTC
AAATCCAGACCAAAGTCTGCTCAAATCCAGACCATGGTCTTTCTTTTAAGGCAAATAGCA
GCATTACTGAGTTAAACAAAGCTCATTCCTTTGTCTGACTTTGTCTTCTTTGGTCTTTTG
CTAATTGCAGGTTTTGCACAACTGGACTTCCTATGGGATCCTCCCTATAGTGA
GenBank Accession AL769316 [GenBank]
Graphic View Graphic view of gene At1g30440
Predicted Position of Insertion Chr1:10759570 - go to primer design
BLAST e Value 2e-64
Hit Clone Code (BAC ID) F26G16
Hit Gene Code At1g30440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phototropic-responsive NPH3 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit MSG15

 
Sequence (A. th genome BLAST matches underlined)
>84-011845-strizhov-D11-8409
TTGATCCATGGTAGATTTCCCGGACATGAAGCCCTTTACAATTGAATATGTCTCGTTTGA
TTCGGAACACTTGTGAGTCTGCCCTAAAAGCGACTATCTGATGCTGAGCCCCACACCTAC
CCGGTCCTCGTGAACAAGAAACGAACTTCCTTTTTTTTAGTACGGATGTCGCGAATGCTT
CAGGCACCGCGCCTCTTATCCTTAATTTTTTGGATATAGACACAATCATACCACTTGCTT
CGAAGACCTGTGAGGAACATACACCTTATCGCCGAAGATCATACTGTGCGCCGGAAAAAC
TACTATCCTATTGATCATGAATGCGAAATGATCTCCGGCTATTATCAAAGATAACCGAAG
GTCGTTGGTTATTAACTATCACATAAACTGCTTGGAAAGACTTAAACTCATATTTCCCAC
ACAAAGTAATTTTTTGATGTTAGGAGGGCTCGAATTTGGATTAAAACCTTCCAACTTTTT
CTGAATTCTCAACCGCCATTTAACCACATATGTGGGGGGTTCATTCTATGATTTGACTCC
AATAGTTGGAGAAATCTAATACTATAAGCTCTTTCTAATAGGCACTACATTATTATAGGA
CGGCTACATAAGCAGGGATCAACCTCGGTGAATCTTATTCGTTTATACCAATATTAATAT
TCATGGTATCTGTAAATGGAGCGATGATATACGACGGCACGTGCGTAATCCGAGAAGTGT
ATATTCTATCATTTATGGGGCCGGGTTTCGATCCGAATCTACGTAGTATACCAATAACAT
CACATATACAGGTTGGGGATCTACGAGAAATTTTATGGTTTAAATGCCCATAAGCTAATC
CATCAACACAAAGCCCAACTTT
GenBank Accession AL769314 [GenBank]
Graphic View Graphic view of sequence AL769314 of line 085D11
Predicted Position of Insertion Chr5:21145937 - go to primer design
BLAST e Value 1e-179
Hit Clone Code (BAC ID) MSG15
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g10430

 
Sequence (A. th genome BLAST matches underlined)
>60-K020161-022-085-D11t-8409
GACATAAGCCATTTACAATTGAATATATCATGTAAATATCTGAATTTGAGTAGACTGCCC
TATGGGATCCTCCCTATAGTGAGAGATCGGGCCCCCCCCCATAATTCTTGGAAAAGAATC
CACCTTTTCCTTTACCTACGGGATCCTCCCTACACTGAGAGACCTCCCTTTAAACCCCAT
AATCGAATCCCCCCCTCCCTCTCGCACGAGCACAGAGCCTCCTCACTTCAACCTCCAATA
ACGGTTTACACTCCGTCTGCTGCTCCATCAGACTGACCATTATCTCCCTTCGACGGCCTC
TTGAAAAGCCACCACCCATCCTATATACGAAACCTACGGCGGATAAACAAGATGAATCGC
CGGACAATCTATCGGCCAGAGCTAATATATCCGAATCGGAGAGATCAAATCCTCCTATGG
GATCCTCCCTATAGNGAG
GenBank Accession BX530766 [GenBank]
Graphic View Graphic view of gene At1g10430
Predicted Position of Insertion Chr1:3430179 - go to primer design
BLAST e Value 4e-58
Hit Clone Code (BAC ID) T10O24
Hit Gene Code At1g10430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation protein phosphatase 2A-2
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit BX530765 [GenBank]


Last Updated on 07.07.2016 14:03