SimpleSearch - Line and FST details


Line specific information

 
Line ID 085D12
Vector Used pAC161
Line Availability only available from NASC (N408112)
Segregation Analysis 100:82:39
Confirmed for Hit At4g14940
Parent of DUPLO pair none
Parent of pair(s) 4005, 89621
Note Although the line exists, the insertion in At3g15010 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in At2g21400 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g21400

 
Sequence (A. th genome BLAST matches underlined)
>92-011849-strizhov-D12-35St
TTGACGTAAGGGATGACGCACAAATCCACTATCCTTCGCAAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTATCAGTGTTTGAGTAACTCTTGATGATTATTACTATTATTATTATAAT
GATGATCTACCATCACTTTGTGGAGTACTTGATCGAGAAGAATCCCTCTGAAAACATGTC
CTCCAATGTTCACCGAGGTCTGATAAGCATATTGCTCTTTTGCATCATCGATTGAACTCA
CTTTTACGCATCGGAAATCTGCTATGGGATCCTACCTATAGTGAAGGCGTTATCACTTTA
TGGTGAGGCCATTATTTTGCCACTTACAAGACAGACTTGGAGGCCCAAATAGGGCTTTTT
GCTTCTTTCTTGCCAACTAACCATTGACAATTCGCCAATCCGAGTGCCATAAGTGCAGAA
AAACGCTCTGGGATCCTCCCTATAGAGATCCTCATATAACATATTTGCTGGCCCGTTCGA
CCTTCCCATTCAAATTACCCCCTGTCGCTTCCCTATCTTCTCGCACTCGCCCTGGGAACA
CTCGCCATACCCCACCCTCCCCCACCCCCCCCTTCTACATCTCTCCTACATTCACCCCTC
TCCCTAAACGCTACTCCGCCTCTCGCCCCATTCTCACCCCCCCCGCACCGACTTCCTAGT
CCCAACCGCCCCAACTATAAATATCCAAACCCCCACACCCTTCACCTCCTCCAAAAATCC
CCATCCTCTCTAATACATTTCCCCTTCCACACACACCCTCATACACCCCCCATCTCATAT
ACTGTAAAAATACTACTCCAACTCATACTTTTTCTGCTTACAATTTACTTTTTTCTACT
GenBank Accession AL769320 [GenBank]
Graphic View Graphic view of gene At2g21400
Predicted Position of Insertion Chr2:9159447 - go to primer design
BLAST e Value 6e-86
Hit Clone Code (BAC ID) F3K23
Hit Gene Code At2g21400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SHI-related sequence3
Insertion Classification CDSi
Confirmation Status failed

Gene hit At4g14940

 
Sequence (A. th genome BLAST matches underlined)
>92-011846-strizhov-D12-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGATCCATGCAGACTGGT
ACAACATCACTATGTCTTTGATCTCTATCTCTCTGTTCCTGTTCCCATATAACAAACCAC
AAATTTATTCCTTAATAAACCAAAAAAAAAAATTACTTACTATAAAAAATAATTTGAACC
TTTAAATTAATCATTTTTACTTAAAATTAATTACCTACTACTCCATACAGTTAACCCGTT
ATCGCCACGGTTCCAATCACTATAAAACCCACCGTCCCATTTTTCGGACCGGTCATAGGC
GGTCACCCAAACCGGATATTTCGGGAAACCGGCTTTTAACTCGGGGTAATCATCATCGGT
TAAAACCAAAGGGGCTTGAAAATGTTCCGGTATCACCCGGTAACCAACTGTATTTCCTAT
TTTCGTCTTCTTGTTCGGGTTTACTATAAACAGCTCAACCGGATCCAACCCGAGTCAAAC
TCTACCGTCAGTTTCCGTTTTCGCCGTCTTTTTAACAACCGTCCAGAAACTCTTCCTCCG
AAAAAACGTTTTGTAAACTCCCGTAACTCTAACCGTTTTGAGTTGGCTTTTCACCAAGGA
ATGGCCGTTACCGACAACGTCAAGGTCCAAG
GenBank Accession AL769318 [GenBank]
Graphic View Graphic view of gene At4g14940
Predicted Position of Insertion Chr4:8544150 - go to primer design
BLAST e Value 1e-152
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation amine oxidase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g15010

 
Sequence (A. th genome BLAST matches underlined)
>92-011845-strizhov-D12-8409
NTTTGATCCATGGTAGATTTCCCGCACATGAAGCCATTTACAATTGAATATATCCTGTAG
CTAACACAGTTCTAGCATGCTGATAAACTAGGAAGAGACACAGGGAAAAGAATAGCAGAG
AATTTGTATGGGATCCTCCCTATAGTGAGTCGTATTGCTCAGGGGCACGTCACGGCGGTG
GGAGATCGAGCAACGGGTGGAAAACGCACGCAAACTCGGGGGGATAAAACCGACACCTTG
AGCTGGACATGCGGCGGGGGAGCCCTTATATCGGGCGGCGCACCTGGTAAGCGTGGAACA
CGAGTACAGCGTGGGAGCGAGCCGATACAATCGCGCCGGCGTCTAGGGTACCGGTCCCCC
CGCTAGAGGTTGATCCACCCCCTCAGCTGGATATAGCGCAGTCGGCGTTCGAATGATAGT
GCATCCGAGTTCTGAAAACGACCTGACTTACAGGCCCTAACTTACGCGACAGGCTGGCGA
CCTGCCTTTAACCTGGCGTTTTGTTG
GenBank Accession AL769317 [GenBank]
Graphic View Graphic view of gene At3g15010
Predicted Position of Insertion Chr3:5054262 - go to primer design
BLAST e Value 2e-09
Hit Clone Code (BAC ID) K15M2
Hit Gene Code At3g15010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNA-binding (RRM/RBD/RNP motifs) family protein
Insertion Classification TS2TE (3')
Confirmation Status failed, line belongs to a contamination group, please check line 085E12


Last Updated on 07.07.2016 14:03