SimpleSearch - Line and FST details


Line specific information

 
Line ID 087B12
Vector Used pAC161
Line Availability only available from NASC (N408280)
Segregation Analysis 151:148:136
Confirmed for Hit At1g76710 At3g25840
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g76710

 
Sequence (A. th genome BLAST matches underlined)
>90-K012440-022-087-B12-8409
TTTGATCCATGTAGACTGTCCTGTACTTGTAGCTACTTACCATCGATTTGTTCCTATATT
ATGTTTGGATTGTGGGATCCGAGCGTGTGGATTTGGGTTGGACTGATTGTTTACTATTCA
AACAGTATTTACGCCTGAATAATGATAAAGCTTCTGGTCTTTTGAGAGTTCTCTTTAGAT
AACCTGAGTGTGGCACTATGGGATCCTCCCTATATAGAGTCGTATCACTCACCTATGGTT
CTTGCCATGATGTTACTTCGCCACAGTACTCCATTATAAATTGCCCGGCCGAAATCATAG
CATGAAATACAACCAGTCATTTACTAAAACCCATATGACTATTTACTTAAGAAAAAGAAT
ACACCACCCATGTTATTTGCCCATTTACATTAGATCAACGAAGTGTGACGGAAATTGTCA
TAAATCTTGGTAAAGAGTATCACACATGATAAAGACACAGGAATAAATTTTGAGGCCTCA
CCTTTATCTCTTCAAGAGCCACTATGGGATCCTCCCTATAGTGAGTCGCATTACTCACGA
CCTCGCACATACAGGGTGATCATTATTATTTCTTTAACAACAGGATAACCCATTTTTGCC
TATATAAAAAAAAAAGGGCTTCGGGACATCGGGTATACAAAACCATTTTGAGATATGAC
GenBank Accession AL769538 [GenBank]
Graphic View Graphic view of gene At1g76710
Predicted Position of Insertion Chr1:28791287 - go to primer design
BLAST e Value 9e-113
Hit Clone Code (BAC ID) F28O16
Hit Gene Code At1g76710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SET domain group 26
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g25840

 
Sequence (A. th genome BLAST matches underlined)
>90-K012260-022-087-B12-8409
TTGGGTTGGATTGATTCTTTACTATTCATACAGTATTTACGCCTGAGTAATGATAAAGCT
TCGGTCTTTTGAGAGTTCTCTTTAGATAACCTGAGTGTTGCACTATGGGATCCTCCCTAT
ATAGAGTCGGATTACTCAGCTATGCATCTTGGCAGTGGGCTACTCCTGTCTTGTTCACGC
TTGTGAAGACCACGCTCGAGATCATAGCATGAATTACTAGCGGCCTTTGACTACAACCCA
GATGGGTATTTACTGAAGAGAAGGAATACACCTCTGCTGTCATTCGCCCATTTACATTAT
ATCAGCGATCTGAGACGGGAGATTGGCTAAATATTGGTTGGGATGTATTCGCGTGCAGAA
GACACAGGAACATCTTTTGAGAGGCTATCCTTTGTCTTTTGGCGAACCACTATGGGATCC
TTCATATAATGAAACGCATCACTAATGAATTAGATCATACAGGTTGATCATTATTATTTC
TTTAACAAAAGATTAAAACATTTTTACATATCTAGATAAAAAAGGGTTTGTGAAATTGGT
ATAAAAAACAATTTTGAGATATGACTCCATATTAC
GenBank Accession BX649692 [GenBank]
Graphic View Graphic view of gene At3g25840
Predicted Position of Insertion Chr3:9457122 - go to primer design
BLAST e Value 7e-58
Hit Clone Code (BAC ID) K9I22
Hit Gene Code At3g25840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40