SimpleSearch - Line and FST details


Line specific information

 
Line ID 087C08
Vector Used pAC161
Line Availability only available from NASC (N408288)
Segregation Analysis 50:49:42
Confirmed for Hit MRC8
Parent of DUPLO pair 12490
Parent of pair(s) none

Gene hit MRC8

 
Sequence (A. th genome BLAST matches underlined)
>59-K012542-022-087-C08-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTGTAAACTATCAGCGATTGAGACGCACGTGCCATAACCCACCTTTCATCTTCTTCTTCT
TCTTCTTCTTCTATCTTCCGCATCCTTCGGACAAGAGAACCAAACCAGCCAACAAAAAAT
AATAGTAATGGAGAGTCGAATTATAAAGAGAGAAGCACGCCATACCTGAGAGATTCGTGC
GTCGACGACGTGAAAATCATTATTATTTACTAATAATAATTGTTATTGTCAATCGATGAT
AATTAAATTAAAATTAGTTTAAAAGTGGTGGTGGAGGTGTTTGATGGGTGCTATGGGATC
CTCCCTATAGTGAGCGTATAAACTCANNNNNNNNNNNNNNGGGAGAGNNGNGAAGCNAAG
AAGCATATATACACTTGCAGATGAGAAAGATTTGGATGCCTTGGAGCTTGAATAAGTTCG
GAACAACCCCGATATCTCATGAAAACTAATAAGCTTTTAAGGTTTTTAGCGACTAATGAT
TACCTGGTTATGTAAGCTA
GenBank Accession AL937602 [GenBank]
Graphic View Graphic view of sequence AL937602 of line 087C08
Predicted Position of Insertion Chr3:6174225 - go to primer design
BLAST e Value 1e-115
Hit Clone Code (BAC ID) MRC8
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23