SimpleSearch - Line and FST details


Line specific information

 
Line ID 087C09
Vector Used pAC161
Line Availability only available from NASC (N408289)
Segregation Analysis 50:49:47
Confirmed for Hit At2g36300
Parent of DUPLO pair 1348
Parent of pair(s) none

Gene hit At2g36300

 
Sequence (A. th genome BLAST matches underlined)
>67-K012440-022-087-C09-8409
NTTCGATCCATGTAGATTTCCCGTACATGAAGCGCTTTACAATTGACACAGCTCGTACAC
GTATGGTTGTATAAGGTTCCCGTTTCTACCAGCAAGCATGTTAAAGACGATCGTATAGAA
AGATAGAGGAGACGACGATCCATCCAAGTATGACACCGAACTGGATCTTACCAGCTAACA
ACTGAAATAAGCAAAGCGCAAGGTACAGAAAGATCGGACCAGATAGATCTGAATCTTTGT
GAACAGCTTGGTTAATCCGAAAAGGATTGAGAATCGATCTATGGGATCCTCCCTATAGTG
AGTCGATTTACTACAAANGNGNNGCCAATAATTAGCTTTTTCGTATGTATAAATAGTTTA
ATATCTTAAAATGTTAAGATTTTTATATTTGGTACTTACAATGTGATGCGTTAGATCGAT
GTAACCTATGGGATCCTCCCTATAGTGAGT
GenBank Accession AL769551 [GenBank]
Graphic View Graphic view of gene At2g36300
Predicted Position of Insertion Chr2:15213595 - go to primer design
BLAST e Value 4e-109
Hit Clone Code (BAC ID) F2H17
Hit Gene Code At2g36300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integral membrane Yip1 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03