SimpleSearch - Line and FST details


Line specific information

 
Line ID 088D06
Vector Used pAC161
Line Availability only available from NASC (N408394)
Segregation Analysis 100:99:73
Confirmed for Hit F28O9
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At2g35530 can not be ordered because the confirmation of this insertion failed.

Gene hit F28O9

 
Sequence (A. th genome BLAST matches underlined)
>44-K016185-022-088-D06-8409
TGTCCTGAAATTTCCCGGACTGAAGCCATTTAAATTGAATATCAAATACCTCCATAATGT
AATCAACGTGACACGATGACATCCCTTCTCAGCTATGTTTGTACACAACTTTCTCGAATC
TGATAATTAAAACAAGAGTTTCATGGTTTTCGTTTTATTGGTAATAACCGTTTCAAAATT
TATCAAAAGCCTATGGGATCTCCCCTATAGTGAG
GenBank Accession AL937670 [GenBank]
Graphic View Graphic view of sequence AL937670 of line 088D06
Predicted Position of Insertion Chr3:21168530 - go to primer design
BLAST e Value 6e-77
Hit Clone Code (BAC ID) F28O9
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g35530

 
Sequence (A. th genome BLAST matches underlined)
>44-K016184-022-088-D06-8409
GATCCTGAAATTTCCCGGACTGAAGCCATTTAAATTGAATATAAAATACCTCCATAATGT
AATCAACGTGACACGATGACATCCCTTCTCAGCTATGTTTGTACACAACTTTCTCGAATC
TGATAATTAAAACAAGAGTTTCATGGTTTTCGTTTTATTGGTAATAACCGTTTCAAAATT
TATCAAAAGTCTATGGGATCTCCCCTATAGTGAGAGAANNGCNAGCANATCANATTCCNT
CTTATTTACTGTAAAAACTCCTCACGCCCATAGAAAGACGGAAATAACATTAAGACTTTT
CGAGCCCAAAGATCCAACAAAAACGTTTGATGAGGCGACATATGGAACGCAAAGGTTATG
TGTTCCAGTGTGCAGATTCCAAGTGTTAGCAACACTCATAAAATTTAAATGAGAAATTCC
AAGGGACTGACAGATCTGAATAGGTCAATCCAAATTCAGATTCATGCTA
GenBank Accession AL937669 [GenBank]
Graphic View Graphic view of gene At2g35530
Predicted Position of Insertion Chr2:14924082 - go to primer design
BLAST e Value 9e-119
Hit Clone Code (BAC ID) T32F12
Hit Gene Code At2g35530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic region/leucine zipper transcription factor 16
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 07.07.2016 14:03