SimpleSearch - Line and FST details


Line specific information

 
Line ID 088H07
Vector Used pAC161
Line Availability only available from NASC (N408443)
Segregation Analysis 100:95:66
Confirmed for Hit At5g62165
Parent of DUPLO pair none
Parent of pair(s) 4514, 4517, 4612, 10049, 10063

Gene hit At5g62165

 
Sequence (A. th genome BLAST matches underlined)
>56-K016184-022-088-H07-8409
TGATCTGAAATTTCCCGGACTGAAGCCATTTACATTGAACCATTTACATTTTTGTGGCTT
GCTTCTTGTTTCAATTGCTACAATACGCCCACAAAATAAAATCATAGGATGCAAAAGAAG
TAAAACAGATCAGTATGTAATCTTTGTGACCATCGATCCATCAGTTGTTTTGTGATGTAG
TAATTGATCTCATAAGATTTGGTTTTGTTGGCCATTGAAAGTCAAAGAATCAATTATTAG
GGACAATGTCCCACATCGGAAGTTGAGTAGGATCTTAAGTGGTATATATAAGATATGGGT
CTCTCCACCTATTGCCAATTGGTTTTAAGTTGGAAGCCCACAGTCTAATATCAATAGCAT
GGAAATCATGTAAAGTTTAAGTTTGATTATTTTTACCAAGGATAAAACCGTGAAAGTCAT
CAAGTGAAAAAAAAAGAGTTTGCTAACAAACCTGCAAGTGAATTTGTGAGTCGTGATTGC
TGGTTTCATGATCTTTTGTGTACTTGCGGTAGCGTTCGATCGTCTTCTGCATACTGATGA
TCAAAAATAGACATATATTTTCAGAAATATGAACTAACGTACTTATCTTCGNATTTGTTT
TATCTATAGCTCTACTATATTTGAAATAACATCTTATCGCAACGAGATATGAAAATTTTG
TTTGACTGTAGTATGATTCTTAGATTGTACTACAATATCTTCTTTGCTGTTGGTAAATCT
CT
GenBank Accession AL937748 [GenBank]
Graphic View Graphic view of gene At5g62165
Predicted Position of Insertion Chr5:24966842 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MTG10
Hit Gene Code At5g62165 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 42
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T32F12

 
Sequence (A. th genome BLAST matches underlined)
>56-K016185-022-088-H07-8409
CATTTAGAAGTTAAAACGATAGAAAATAAGAGAAATAAAAACTACTAAATTTATCTATGA
AATAAATTAAAATTCTTTCAATAAAATAGATAAAACTGGTTATTTCGTCAGGTTTGGGAT
CATTCGAAACTAATTTAAAATTGTTCGTTTCAGAACAAGATATCATGTATATACGTAGTC
CAAATCACGGTTTTTAGCTCCGAATGTAGGTATAGGTGAGGCTTTTACTCTGACACTTTC
TTGTAATTCCGACCAAAAACTACACCTATGGGATCCCGCCTTATAGTGAGGAGNNAACAN
GAAAGAGTTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCGGCG
GenBank Accession AL937749 [GenBank]
Graphic View Graphic view of sequence AL937749 of line 088H07
Predicted Position of Insertion Chr2:14887918 - go to primer design
BLAST e Value 3e-88
Hit Clone Code (BAC ID) T32F12
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40