SimpleSearch - Line and FST details


Line specific information

 
Line ID 089C04
Vector Used pAC161
Line Availability only available from NASC (N408476)
Segregation Analysis 100:86:86
Confirmed for Hit At4g34850
Parent of DUPLO pair none
Parent of pair(s) 1721, 90532

Gene hit At4g34850

 
Sequence (A. th genome BLAST matches underlined)
>27-K016187-022-089-C04-8409
TGTCCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGGGAGACGCATCC
GGTGGACCATGCGTCTCGAACCGGATTGAGAAGCGGCTTAACCTGTCTCCTGAGAAGCTG
AGTCCGAGCACAAGAGCTCTCATGGACTATGGCAATGCGAGCAGCAATTCAATTGTTTAT
GTGCTGGAATATATGTTGGAGGAGAGCAAGAAAGTGAGGAACATGAATGAAGAATAAAAC
GAGTGGGGTCTGATTCTTGCTTTTGGACCTGGTGCTACATTTGAAGGCATTATCGCTCGA
AACCTTGATGTCTGAACAATAAGATTTTACCTTGCAGATCGAGAAAGAACCCCTTATGCT
TTAATCAACACATGAAGCTAAACATACGAAATATTTTCTAACGATGCTTAAATCTTTCAT
AGTCTAAAAATATTTCACAAAGCAAGCAACGTAAAATTTGCAATTGAAAAATGAAGAAAA
GAGTCGTTATCAGCATTAAAGCCAGGAATCACGAAGAAGGTTCTTCTTAGCTCATCTCTT
TCCAACGTTTTCAACAAGTCCAGGAGTTGGATCTTCTCATAACGGGTTTCATCTGTTTGT
CTTCCTCAAGACAAACCATACCAACATGTGACGGATCTTCCAGCATCATCTTGGCTACTA
AGTATCCTGCGACTGACCAAGTCTGGTTTTTACGCGACTGTTTCCCCACGTATCTCCCTA
CCTTTCCATCATAGTATTCAGCANGGGGGTCCTTATGAAGC
GenBank Accession AL937796 [GenBank]
Graphic View Graphic view of gene At4g34850
Predicted Position of Insertion Chr4:16609464 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11I11
Hit Gene Code At4g34850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chalcone and stilbene synthase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL937795 [GenBank]


Last Updated on 31.08.2016 09:40