SimpleSearch - Line and FST details


Line specific information

 
Line ID 089F01
Vector Used pAC161
Line Availability only available from NASC (N408509)
Segregation Analysis 100:88:84
Confirmed for Hit At1g11430
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F3H9

 
Sequence (A. th genome BLAST matches underlined)
>06-K016186-022-089-F01-8409
TGTAAGTTCCTCATGAATCCAGGAATGTTCAGGCCAAAATGAACATAATATAGAGAACTT
GTTTTTACGAGAAAAAGTAGATGGGTTTCACTTGTTGTCTATGGGATCTTCCTTATAGTG
AGAGNGANGGAAAGNATATTCACCCGATTTATTTCAAGATGTGCCTGACTACAACCACGA
CTACAAGTTTACCAATGGATCTGCTTATCGAGCGCTTTTTTTCCTTCGTCTCCCCCCACG
ACTCTCCACTTGCGCAAATGGATCTGGTGCACCACCACCGTCACACTGAGCCCGCTTCTC
ACGTGACAGCCCATATAGCGCTACGACCGCTCCGTGCAGGCGCCCGCTCTCCCGGCCCCC
CACTGTCGGTCCGCCACCTGATCCACTTTCTTTGGTATGCAACCAGGTCGACCCAAACCA
CCGCCACTCGTGGACCACCCACACCCATGTGTGCCCCACGGCGGCTCCCCTCCCATCGGT
CGTCCATCCCAACCCTACGGGGCGGGCCCAATAATTAACCCGAAACCCACCCCTGGCCAA
CAATTGCGCACCACAGAACAGGAACACCACCCAGATCAGCCGCAGGGGTAAAAAACCGAG
AGAGCACACAAATATCGGGGCACCGGACGGGGGGGGACCCAAACGGGCAACAATGGTAAG
ATCGGGGCACACAGCGCCGGCCACCGAGTAGGCCACCCGTACACTGCCCCGCCTCCACCC
CCGGATCCTTACATGTTTGGGACCACAAAACAGACACCGGA
GenBank Accession AL937850 [GenBank]
Graphic View Graphic view of sequence AL937850 of line 089F01
Predicted Position of Insertion Chr1:9908369 - go to primer design
BLAST e Value 5e-37
Hit Clone Code (BAC ID) F3H9
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g11430

 
Sequence (A. th genome BLAST matches underlined)
>06-K016187-022-089-F01-8409
AATGAAGCCTTTACATTGAATATATATCCCATGTATATTTCTCTATATACTCCCATGCAG
ATTTCCCTTACATATTTCCCTATGGGATCCTGCCTTATAATGAGATTACTGTGAGGTTAA
GTTTATTAACAGGTTTTAGTTCGGGATTTGTTTTACTAAAAACATAGTTCAGGGTTTAAA
AATGGATCTGACCAATGAGAGTTTTTTTTCATTAAATTCCCTATGGGATCCTCCCCTATA
GTGAGAACAATGAGCATAGAGAGACGATTATGCTTCCTGGTTGCGATTACAATCATTGGC
TCATTGTAATGGAGTTTCCTAAAGATCCAGCGCCAAATAAGGATCAGATAATTGATACTT
ACCTTAACACTCTTGCTACTGATCTTGGCAGGTTCGATTTCGCTTTCTTATTGATTCTCT
TCGTTGATGAATTAGTTAACTAATAGACGACATTTACTTGTGTTGCTAATGGACTTGTCC
TTTGATTGAATCCCATGCTGCGGATAAAAAAATTTGGGTTTTTGTTAAATTAAAGGTTTT
GATGATACTTTCGGGTAA
GenBank Accession AL937851 [GenBank]
Graphic View Graphic view of gene At1g11430
Predicted Position of Insertion Chr1:3847284 - go to primer design
BLAST e Value 1e-124
Hit Clone Code (BAC ID) T23J18
Hit Gene Code At1g11430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plastid developmental protein DAG, putative
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03