SimpleSearch - Line and FST details


Line specific information

 
Line ID 089F05
Vector Used pAC161
Line Availability only available from NASC (N408513)
Segregation Analysis 100:96:77
Confirmed for Hit At5g03150
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g03150

 
Sequence (A. th genome BLAST matches underlined)
>38-K016186-022-089-F05-8409
TGTCCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATACTCAATACTCATTTCTG
TTTTATTGCTCATCACACATAGAGCGTTCTGCGACGCATTAACTGAGGAAGGAGCGAGGA
TGAGTTCACTTAGTAACAACAATCCGGTGATCTCTACGACGAATCTGAATTTTGGAAATG
AGTCAAATGTTATGAATAATCCAAATCTTCCTCATGGATTTGTACACCGAGGAGTTCATC
ATCCCGACATTAATGCTGCTATCTCTCAATTCGGTCTATGGGATCCTCCCTTATAGTGAG
ANNNNANGANCCNCCTTCCTTTTCCTCTATCTTCACAATAAAGTGACAGATAGCTGGGAA
ATGGAATCCGAGGAGGTTTCCGGATATTACCCTTTGTTGAAAAGTCTCAATTGCCCTTTG
GTCTTCTGAGACTGTATCTTTGATATTTTTGGAGTAGACAAGCGTGTCGTGCTCCACCAT
GTTGACGAAGATTTTCTTCTTGTCATTGAGTCGTAAGAGACTCTGTATGAACTGTTCGCC
AGTCTTTACGGCGAGTTCTGTTAGGTCCTCTATTTGAATCTTTGACTCCATGGGAATTGG
GGATCCTCTATGGGATC
GenBank Accession FR802700 [GenBank]
Graphic View Graphic view of gene At5g03150
Predicted Position of Insertion Chr5:747642 - go to primer design
BLAST e Value 1e-114
Hit Clone Code (BAC ID) F15A17
Hit Gene Code At5g03150 [TAIR] [MIPS] [SIGnAL]
Gene Annotation C2H2-like zinc finger protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23