SimpleSearch - Line and FST details


Line specific information

 
Line ID 093E05
Vector Used pAC161
Line Availability only available from NASC (N408885)
Segregation Analysis 50:47:35
Confirmed for Hit At1g48000
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g48000

 
Sequence (A. th genome BLAST matches underlined)
>37-011954-strizhov-E5-8409
ATGATCCATGGTAGATTTCCCGGACATGATAGCCTTTACAATTGATGTTAATCATTGTTA
AGCACATGTCTATAGTTAAGAGTTGGATAAACTATCAAGTAAGTAAAAGTAACCGAAGAA
GTAATTTAAATTAACATCATTTATTTATCGATATAATTTAGTTGATGCAACAAACCCTTT
TTTCTGTAGTATATAATTTTGTTTAGTTTTGATTCAGGTTTCCTTTTATTAAACCAAACT
ATGGGATCCTCCCTATAGTGAGTCGATTTACTCACTCCCTCATTAATTAAAATCTTTCTC
AGAGCAATCTTCTCACAAGTTTCTAAGAATCTCAAAGCATGAATATAAGTAGAACAGAAT
TCGCAAACTGTAAAACCCTTATAAATCATAAAGAAGAAGTCGAAGAAGTCGAGAAAAAGA
TGGAAATAGAAATAAGGAGAGGTCCATGGACTGTGGAAGAAGACATGAAGCTCGTCAGTT
ACATTTCTCTTCCCGGGGAAGGAAGATGGAACTCCCTCTCTCGTTCTGCTGNAACTTTCT
TAGGCCTTTTGCATATATATTTACCGAAATATGGGATCATGCCTGATATATTATATG
GenBank Accession CR770121 [GenBank]
Graphic View Graphic view of gene At1g48000
Predicted Position of Insertion Chr1:17706657 - go to primer design
BLAST e Value 2e-150
Hit Clone Code (BAC ID) T2J15
Hit Gene Code At1g48000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 112
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40