SimpleSearch - Line and FST details


Line specific information

 
Line ID 094H05
Vector Used pAC161
Line Availability only available from NASC (N409017)
Segregation Analysis 100:85:77
Confirmed for Hit At1g54370
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g54370

 
Sequence (A. th genome BLAST matches underlined)
>40-012026-strizhov-H5-8409
TTGATCCATGTACTATTTCCCGGACATGACTGCCCTTGACATACCCGAAATATGTCCGGA
CGCGCGCTGACACTTTTCACTCTCGACTGGGCCCAGATTGCCGAAAACTACTCTTTTCTC
GCAACCTTAAATGTATATTATTAATTGGGAAGCATCGTGTGAATCCCACCTTTTGAAGGG
TACTTAAAAACTAACGCAACGAAGTCGTTGTAGATTACAATACCAGCGACTACTACAACT
ACAGAGCCGTCGAGACCACCGCCTTCTGCGAGCATGTGTCTTACATCAATACCAGAATAC
CTATCCGCTGAATAAGTGTTGTCATAAATACAAGTAGACAGGACGAGAGTCGCTTTGTCT
ACTTACAAAGAATACGGGAAAAGTACAATGGGACAACACTCCAAGTTATGAAGATTGAGG
AAGATAAAAGAGAATTCAGTAGCACTGCATTGGCACCTTGTCTATAGAGTATTAACAATG
TAAATACAACAGTATACAAAGAGTTAAGAAAAGATATGGCACTTACTTCTCGGTGTCCAA
TCCTGCATACTTAAAGAGGTGGTCTGAGTTAATATTTTACAATACATTTTTTGGCCATGT
GACATTTAATAAAAAAACACGAGGATTCCGAAGAAGGATTTTGGAACCTTCCTTAATACC
AACCCCCCTCCCTAGAATATTATATTTAAACCTGGTTCCCCTCCCTTAGGCGCCTTCTAA
TCCACCCACATCCACCCACCAGTCCCCTCCTCCCCACAACTTTTATCCCGGTCTCGCACT
CACGCTCCCCCAACTATACGTCCTTCAACACATACCAAAAATA
GenBank Accession BX546528 [GenBank]
Graphic View Graphic view of gene At1g54370
Predicted Position of Insertion Chr1:20294664 - go to primer design
BLAST e Value 2e-83
Hit Clone Code (BAC ID) F20D21
Hit Gene Code At1g54370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sodium hydrogen exchanger 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit MQJ16

 
Sequence (A. th genome BLAST matches underlined)
>40-012060-strizhov-H5-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACATGGGTACCCGGGTATCACATTGTCGTTTCCCGCCTTC
GGTTAAACTATCAGTGTTTGACAGATATATTGGCGGGTGGGACTCCTGCCTATTGTGACT
CAGAATATTTACTGTTATGCATTAGATTTCCATGTACTTCTAATTATATAAACTCTTAAT
CCTGATTGTATGATCTCTTTGTAAATTATGTGAGTCTTTTTTTTTTTTTAAACATCGTGC
GAATGATGGAAAAGCGAAAGAGGCGGGCTTTTCAAAAGAAAAGTCTTTACACTGGAAATT
CGCGCAACCCCCTCTTAAAGGATTTGATCGCAAGTACAATCGAGCCGACGTTCACGGTAC
CGGGCCCCCCCTCGAGGTCGATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTTTGAC
GTTCAATGCAGCCGTCTTCTGAAAACGACATGTCGCACAAGTCCTAAGTTACCCGACAGG
CTGCCGCCCTGCCCTTTTCCTGGCTGGGATCCTCCCTATATAGAGTCCCAATCCTAAACA
CCCCCGGGGAAACAAAAACCTGAAAATTCAC
GenBank Accession FR802845 [GenBank]
Graphic View Graphic view of sequence FR802845 of line 094H05
Predicted Position of Insertion Chr5:7509521 - go to primer design
BLAST e Value 4e-10
Hit Clone Code (BAC ID) MQJ16
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40