SimpleSearch - Line and FST details


Line specific information

 
Line ID 095C11
Vector Used pAC161
Line Availability only available from NASC (N409059)
Segregation Analysis 100:100:74
Confirmed for Hit At1g66560
Parent of DUPLO pair none
Parent of pair(s) 97072, 97074, 97075

Gene hit At1g66560

 
Sequence (A. th genome BLAST matches underlined)
>83-012059-strizhov-C11-35St
TTGCGTAAGGGATGACGCACAATCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTGAATGATAAAATTCGACCAGTCGTGTCTGAATCGGGTATGC
CTCAGCTCGCATCAATAGACGAACAAACAATTACCATGGAGGACGAAGCCATAGACCAGT
ATCATGAACCAAGAATGTGATATTAATGATTTTTCTGTGGATGATGACCCATTTTGGGCT
ATGGGATCCTCCCTATAGAGAGCCATTTCACTAAATTCTAATTCGGAAATCTTTATTTCG
ACGTGTCTACATTCACGTCCAAATGGGGGCTTAGATGAGAAACTTCACGATCGATGCCTT
GATTTCGCCATTCCCAGATACCCATTTCATCTTCAGATTGGTCTGAGATTATGCGAAAAT
ATACACTCATATACATAAATACTGACAGTTTGAGCTACCAATTCAGTGTAGCCCATTACC
TTACATAATTCACTCAAATGCTATGGGATCCTCCCTATAGTGAGCGTTTATACCCTAANN
NNNNNNNNNNNNNNNCCTTTAATATTTTTTAATTTCTTAA
GenBank Accession FR802859 [GenBank]
Graphic View Graphic view of gene At1g66560
Predicted Position of Insertion Chr1:24834406 - go to primer design
BLAST e Value 3e-60
Hit Clone Code (BAC ID) F28G11
Hit Gene Code At1g66560 [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 64
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX546529 [GenBank]


Last Updated on 14.10.2014 10:23