SimpleSearch - Line and FST details


Line specific information

 
Line ID 095G12
Vector Used pAC161
Line Availability only available from NASC (N409108)
Segregation Analysis 50:49:47
Confirmed for Hit At4g38380
Parent of DUPLO pair none
Parent of pair(s) 6542, 6543, 6545, 6558, 8892, 8896, 8898, 85694, 85781, 85802, 85830, 85835, 85844, 85845, 85848, 85849

Gene hit At4g38380

 
Sequence (A. th genome BLAST matches underlined)
>95-012059-strizhov-G12-35St
NATGGACGTAAGGGATCACGCACTATCCACTATCCTTCGCAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTATCAGTGTTTGACACCGCAATCAGGGTTAGTCTGGCTCTTGCGGCGAG
TAACAAAAGGGAACATGGGGTTTGGATTGGTGTGAAGGGAGCATTTTTGGGGGGCAGAGA
CATTATTGATCCGAGATAGAGGTAGAAAAGTCCCTTGTTGGATTTTGGGTTTGGCAAAGC
TATGGGATCCTCCCTATAGTGAGTCGATTTTACTC
GenBank Accession AL770012 [GenBank]
Graphic View Graphic view of gene At4g38380
Predicted Position of Insertion Chr4:17974569 - go to primer design
BLAST e Value 3e-85
Hit Clone Code (BAC ID) F22I13
Hit Gene Code At4g38380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MATE efflux family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g27400

 
Sequence (A. th genome BLAST matches underlined)
>95-012025-strizhov-G12-8409
TGATCCATGTAGATTTCCCGGACTGAAACACTTGGAGAGAATAAGATATCCCTTCGTATA
TTACTGGACAAACTCCAGTAAGGCTATAGAGGTGTTGCGTTATCCCTTTGTTACTCTTTG
GCCATGTTGCTTTGCGTTTCTTGCCTATGTAATGCTTTGGTCTCCGTTCTTGCTATGGGA
TCCTCCCTATAGTGAGACCTATTACTAAACTATATGAACCATAGTTAACTTTGGTTTTTT
GGAAAAACCGAAAAGGGTTTTCCTAAATTTAAAGTTTAGTTTACAAAAACCCACTAATGG
GGAACTGAATCTGTAAATGGGACCCATAGGGATAATTGAATCAAAAAAATATTGTAAAAC
ATTTTTTATGGAAAAAAAGGCTGCATTTGGTTTCTACTTCGAATGTATGATATATCACTT
ATATTAACAAAAGCAACATTGTTATATATATCAAACTTCAAATTATCATATTCAAAATTT
TCTTTTTCACGTACCTGTTAACGTCGTCAACGACTATGGGATCCTCCCTATAGGGAGTCG
GenBank Accession AL770011 [GenBank]
Graphic View Graphic view of gene At3g27400
Predicted Position of Insertion Chr3:10140892 - go to primer design
BLAST e Value 3e-122
Hit Clone Code (BAC ID) K1G2
Hit Gene Code At3g27400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pectin lyase-like superfamily protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03