SimpleSearch - Line and FST details


Line specific information

 
Line ID 096A10
Vector Used pAC161
Line Availability only available from NASC (N409130)
Segregation Analysis 50:49:49
Confirmed for Hit At1g02170
Parent of DUPLO pair 2565
Parent of pair(s) none

Gene hit At1g02170

 
Sequence (A. th genome BLAST matches underlined)
>73-012024-strizhov-A10-8409
TTGTCCATGTAGATTTCCCGGACTGAAGCACTTTCTGTGTTTCTTTCTTGTCTTCTTACC
TTATTACATTATACACTCTCTACTTTCATCTTGTTTGGTTGAGTAATGATTATATGGCGT
GGGGTTACGAACACCGCTAAGGGACATCTTTACTACAGTGACTTCAGTAATCCAATCTAT
GGGATCCTCCCTATAGTGAGTCGTATTACTCAAAANNNGNNNATATGGATGGTTTTCATT
CTCANAGGAAGAAAAGGATCCATAAGGTATCCCGACCAAGCAAAACATGAGGATGGCATT
GTATTGGCTCGTACAGGGATGCGCAGCAGGCGACTCACTTGTCTTCCACTACTCTGGTGA
TGGCTCGCGTCAAACAAACCTCACCGGTGTTGAAGT
GenBank Accession AL770038 [GenBank]
Graphic View Graphic view of gene At1g02170
Predicted Position of Insertion Chr1:412273 - go to primer design
BLAST e Value 5e-62
Hit Clone Code (BAC ID) T7I23
Hit Gene Code At1g02170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation metacaspase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40