SimpleSearch - Line and FST details


Line specific information

 
Line ID 097F09
Vector Used pAC161
Line Availability only available from NASC (N409285)
Segregation Analysis 50:49:44
Confirmed for Hit At1g32340 At3g17860
Parent of DUPLO pair 12778
Parent of pair(s) none

Gene hit At1g32340

 
Sequence (A. th genome BLAST matches underlined)
>70-012023-strizhov-F9-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATACCTGTTGT
GATATACTCCATTAGTGTTCAAGCCTCTTGTGCGCTTTTGTGGCTCCGAGTCCGTTTGTG
CTACTTCCAGCTTCAGGGCTAAGATAAGATACTTGTAGGCATGAAGCTATGGGATCCTCC
CTATAGTGAGGCGTATTACGACACGCCATGAGAGGAACACACGGAGGCAGGGGAAGAAAT
CACGACCGCCGCTACATCCGCCGTGACGCTGGGATGGGGAATCCAGTCAACGATCATCCA
AAATCAGAGCATCAGAAAGAAGACACGACTTCGACGGATTTATCATCGGCAGCAGCTTTT
CCGTCTACTTCTCAGCCAATCCAAAACCTCGATCATTCTACAAAACCTTCAAAGTCTCAC
CGGAATCGACGCAGCCGTGGATCAAATTCAAAACCTCGTCCCGTGGAGAAACCGGAGGTG
AATTCAGCTGAATCCGATGCCGATGACCGACTGCCAGACGAATTAAACAGGTTAACGGCG
AACCACAATCCCCCTTCCGGACCCGGCAAGGGACAGGTCGGCGCCCGGCCCTCGGGGCGG
GGCGGCGCCGGCCCACGCCCGCGCCCCGGNCAGGCCGCGTTCGCGCCCGTGCGAGAGGAC
GGAGGAGCGGAAAGCTTGGGAGGCCGACGCGCGCCTGTCGCGCGGAGGGGGGGGCGGGGC
CGAGCGGGGGGCTCAGAACTCCCCGCGCCCGCACCGGCGGCCCACTTCCAACCCCCTGAG
CGGNGGCGCGAGGGGAGAGAGGACGCGCTCCACCCACCTCCGCCCGCGGGACGGCCCGCG
GCCCCCGCGCCGCCCCGCGCGCCCGCCGGCCANACAATCTCGAAGACGAGTTTAGTATCA
AAGAGAAGCGGCGAGGGGGAGAGACGAAAGAAGAAAAAA
GenBank Accession AL755425 [GenBank]
Graphic View Graphic view of gene At1g32340
Predicted Position of Insertion Chr1:11666186 - go to primer design
BLAST e Value 4e-152
Hit Clone Code (BAC ID) F5D14
Hit Gene Code At1g32340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NDR1/HIN1-like 8
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g17860

 
Sequence (A. th genome BLAST matches underlined)
>70-012057-strizhov-F9-35St
TGACGTAAGGGATGACGCACAATCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTAGACTATCTATTGTGATGGTGGATTTATACAAATGGGACCCGCCGCCGACAGA
GGTGTGATGTTAGGCCAGGACTTTGAAAATTTGCGCAACTATCGTATAGTGGCCGACAAA
TTGACGCCGAGTTGACAGACTGCCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCAC
ATTCGCCATCTAACTTACTAGTATTTTCATGGATGTAACTTCATTCTCGTTCTGTTTCTT
ATGCAGTGGCATTACCTCTGGCTCGCAAAGCATCCCTGGCTATGGGATCCTCCCTATAGT
GAGTCGTATTACTCAGNGTCTACATTCACGTCCAAATGGGGGCTTAGATGAGAAACTTCA
CGATCGATGCCTTGATTTCGCCATTCCCACATACCCATTTCATCTTCAGATTGGTCTGAG
ATTATGCGAAAATATACACTCATATACATAAATACTGACAGTTTGAGCTACCAATTCAGT
GTAGCCCATTACCTTACATAATTCACTCAAATGCTATGGGATCCTCCCTATAGTGGAGCG
TATTACT
GenBank Accession AL755426 [GenBank]
Graphic View Graphic view of gene At3g17860
Predicted Position of Insertion Chr3:6122384 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) MEB5
Hit Gene Code At3g17860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation jasmonate-zim-domain protein 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40