SimpleSearch - Line and FST details


Line specific information

 
Line ID 098D07
Vector Used pAC161
Line Availability only available from NASC (N409355)
Segregation Analysis 100:73:61
Confirmed for Hit At2g37170
Parent of DUPLO pair none
Parent of pair(s) 89538, 89541, 89546, 89550, 89554, 89557, 89561, 89562, 89563, 89564, 89565, 89566, 89567, 89568, 89569, 89572, 89578, 89581, 89586, 89590, 89593, 89594, 89595

Gene hit At2g37170

 
Sequence (A. th genome BLAST matches underlined)
>52-K012117-022-098-D7-35St
TTGCGTAAGGGATGACGCACAATCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTGACTGTATAAAGACCACTTGGTAAGCTCGTCCGCATCGAAA
AACGGAGTTGGTGGCGGATCTTCGTAGTCTCTTGTCTGAAATCCCTCAGGTCCTTCCACG
TCTTTGGCCATTTCTATAACTTTTTTTGTTATATATGAAAGTTGTGTTTTGTATTGTGGA
TATGTTGTGTTTGTGAAGACTGAAGAGACGAATGAAAGTTGTTTATATAGAGAGACTATA
GCTATAGTGAGTGCTCTCATTAATTTTGCTTGTCAATATACGTTAATAATTGTATACGTG
TTATTGATTGATTATATTACGATAATGTTTTCCTTTTGGTAGGCNTTATGGTTGTTTTTA
TTATTCGTTTCAATGAAATGAATATAGAATTGTGTGTATGACGATTATGATTATTTTTGT
GGAAACTTTCTTTCACTAATTAATTACCTATGGGATCCTCCCTATAGTGAGTCGTTTTAC
TTAACNNNNNNGGNNGGGGGNGGGNNGNNCNGNNNGNNCCCGCCCGCGCCCGGCGGGGCG
GGGGGCGCCCCCCCGCGGGGGGCGCCGCCCCTGNGGGGGGGCGCCGGGGGCAACGCCGCC
GCCCGACCGAGGGGGGGCCGCCCGCCGCCCCGAGTGGATGGCCGTGCGTGGCCCGCGGAA
GGAAGCGCACGCCACGCGAACGAGGGGAAAGTCTGGGGAGAGAAGGAGAGCGAGCACGAG
GCCTGTTAAGCGGATAACGGGAGGAACGGAGGG
GenBank Accession AL755492 [GenBank]
Graphic View Graphic view of gene At2g37170
Predicted Position of Insertion Chr2:15614682 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2N18
Hit Gene Code At2g37170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plasma membrane intrinsic protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL755492 [GenBank]


Last Updated on 31.08.2016 09:40