SimpleSearch - Line and FST details


Line specific information

 
Line ID 098G12
Vector Used pAC161
Line Availability only available from NASC (N409396)
Segregation Analysis 75:49:23
Confirmed for Hit At3g20910
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g20910

 
Sequence (A. th genome BLAST matches underlined)
>95-K012117-022-098-G12-35St
AATTGACGAAGGGATGACGCACAATCCACTATCCTTCGCAGACCCTTCCTCTATATAAGG
AAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTT
CGGTTTAAACTATCAGTGTTTGATGGCACAAGAACCAGTTTTCGTGAATGCTAAACAGTA
CCAGGCGATTCTGAGGCGAAGGCAGGCACGCGCCAAGGCAGAGCTATGGGATCCTCCCTA
TAGTGAGTCGTATTTACTC
GenBank Accession AL755522 [GenBank]
Graphic View Graphic view of gene At3g20910
Predicted Position of Insertion Chr3:7327837 - go to primer design
BLAST e Value 1e-40
Hit Clone Code (BAC ID) MFD22
Hit Gene Code At3g20910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit A9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL755522 [GenBank]


Last Updated on 31.08.2016 09:40