SimpleSearch - Line and FST details


Line specific information

 
Line ID 099A09
Vector Used pAC161
Line Availability only available from NASC (N409417)
Segregation Analysis 50:36:35
Confirmed for Hit F16P2
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F16P2

 
Sequence (A. th genome BLAST matches underlined)
>65-012074-strizhov-A9-8409
TGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGGCGGGT
AAACCTAAGAGAAAAGAGCGTTTATTAGAATAATCGGATATTTAAAAGGGCGTGAAAAGG
TTTATCCGTTCGTCCATTTGTATGTGCATGCCAACCACAGGGTTCCCCTCGGGAGTGCTT
GGCATTCCGTGCGATAATGACTTCTGTTCAACCACCCAAACGTCGGAAAGCCTGACGACG
GAGCAGCATTCCAAAAAGATCCCTTGGCTCGTCTGGGTCGGCTATGGGATCCTCCCTATA
GTGAGTCGTATTACTGAGATCTTCAAGATATCCTTGGATACAAAGACAAAGAGAAAGCAA
AATGGTCCTTTTATTTATTTGTTTATTTCACCACCCATAACTTCATTTGTGTATAGAATA
TAGTAAACTCAAGTAATCAAGCAAGTAAACGAAACATAAAAAAGAAAAGTAGTGCAAGAA
ACAGAGGAGTTAGATACCAAAAAGTGAGAGATATCGAATGGCGGAGAAAGAAGAGAGTGT
GAAGCTTCTATGGGATCCTCCCTATAGTGAGTCGTATTACCTCAACTCCTCTCCTACAAC
CAGCTCTCTCCCCTCCTCTCCAACCGCTTAATCCGACTAAATCTCGTTTGTCTATTCCTT
CCT
GenBank Accession AL755541 [GenBank]
Graphic View Graphic view of sequence AL755541 of line 099A09
Predicted Position of Insertion Chr2:12632560 - go to primer design
BLAST e Value 7e-129
Hit Clone Code (BAC ID) F16P2
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g63135

 
Sequence (A. th genome BLAST matches underlined)
>65-012118-strizhov-A9-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTACTCAGTGTTTGCTACATGTTTATTGATACATGTCTTCCAATGATAGAAAA
CTATGGCACTCTCCCTATTATGAGTTTTATCACTTATAAAGCTATAATGATGATAGTCCA
ATGAACACAAATGCATATATCCATATAGTCTACACTGGAAAAACCACTACACTATGGGAT
CCTCCCTATAGTGAGCCGCTTTACTAACCGAGTGATCCACACTGGGACTTTTAAACATCA
TCCGTCGGATGGTGTTGCGAGAGAACCAATCGATCCGTGAGATCATCCGACGCACCGGGC
ATGCGCGCAACACGATCGCATACTATTTGAACGCAAGTACAATCGAGCCGACGTTCACGG
TACCGGGCCCACCCTCGAGGTCGATCCAACCCCTACGCTGCTATATGGCAGACAGCTTCT
GACGTTCAATGCAACCGCCTTCTGACAACGACATGTCGCACAAGTGCTAAGATACACCAC
AAGCTGTCGTACTGCCCTTTTTCTGGAGTTTTCTTGTCCGCGAGACCAATCTGCATAAAG
GACAATACTTTGAACTATGGGAACACTCCTATAGAGAGTAGCCTTACCTCAAAAACTGGG
CACCTCAATCCCTCCCCACGGGGGCCACGGGNCATTCTTAACTTCTTTCTTCCACCGGGC
CCTCTTCCCCGGACCTTGAAAAACTTATCCCTCCTAAACCTGAACTTTTACCTTCCTCCT
CTCT
GenBank Accession FR802929 [GenBank]
Graphic View Graphic view of gene At5g63135
Predicted Position of Insertion Chr5:25325769 - go to primer design
BLAST e Value 3e-29
Hit Clone Code (BAC ID) MDC12
Hit Gene Code At5g63135 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23