SimpleSearch - Line and FST details


Line specific information

 
Line ID 099B01
Vector Used pAC161
Line Availability only available from NASC (N409421)
Segregation Analysis 50:25:18
Confirmed for Hit At1g18880
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g18490

 
Sequence (A. th genome BLAST matches underlined)
>02-012118-strizhov-B1-35St
TTGCGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTAAATGGCTACTTTTGACTATGGGATCCTCCCTATAGTGAGT
CGTATTACTCANCNGCANNANCGCGTGCGTACAAACTCCGGCCAGCACAGAGCCCACGTG
GCCGACAAACTCCGACCTGTCTATCCTACCCTTCTCGACATGACTTCTAACTTCTTCATC
TGCAGGGAGATCACTCAATGGGATCCTACCTAACGTGCGTGGCATTACTCGGGTGAAATG
CAGCATTTATCTCTATCATACACACTATGGGACTCCTCCCTCTAGCGAGACGTATCACAT
CATACCAATCCCCCCTAGAACGACGTCGCCTACACGACCTCTTCCCCAACCAC
GenBank Accession FR802930 [GenBank]
Graphic View Graphic view of gene At5g18490
Predicted Position of Insertion Chr5:6134838 - go to primer design
BLAST e Value 7e-06
Hit Clone Code (BAC ID) F20L16
Hit Gene Code At5g18490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation vacuolar sorting-associated protein (DUF946)
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At1g55800

 
Sequence (A. th genome BLAST matches underlined)
>02-012074-strizhov-B1-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTCTTATC
CCCGGACATTTTGCTGGACTATGATTCACCTACAAACCTTCATACTCTACTTACCNTGCT
ACTTCCTTACTATAAGGCAACTATCACGGATATATTGACCTGACTTTAACGGTTCCTGTG
CCATCCTAATTCTTAGCTTCCTTGATTCTCCAGTGCTGCACCGTATAAACATTTTACGTA
CTCTCCAGTTATGAATTCCATGAAAAACTCCTCTGAATCGGCACAGAGACGACAGGGAAC
GCGTTCTTGGCTATGGGATCCTTCCTATGGAGACTCTGCTNTACTCAACAAGTGGAGGAA
GTTAAATGCGTGATCCGGGTGCTTCCGGTTTGGCTCTCGGCCGCCTTATTCTACCTATGG
GATCCTCCCTATAGTGAGTCGTATTACTGAANNCTNCCTNTANTGAGTNGTATAAACTCA
ANNNNTNNCNCCCCGCTGTTCTGTCCTTNCCCCTGGTCCCCCCCGCCCCCGCGCGGGGCC
CCCGCCCCCCTCTCCCGGGCGGTGGCCGCCGAACCCGACACCCCGGGTAAAATTGCCCCC
CAGGCGAAGCCGAACCGCAGGCACAGCACCGGCCTGAATAGTACGGGAAACCTGCGCTGG
CGCCCATCCGCCGGCGGTGACGCCGGGAACATAGAAAGAATGTAGAGGTCGCGCGAAGGG
GGTCTAGCCCGCGCACCATCCACGGAAAGACCGTGGACACTGCGGGGGCGACACGGGAGC
GAGAGAGAACCCGACCGCCGCAGCTGTATTTAAGGACAAAAGAGCGAAACGCCCCCGGCG
TTTAAAAACCGGCGCGGCATCACATGAGCAAAGGCACGGTGCGACGGGCTGCCCGACGCT
GCCGATCGGCCGAGTCTCCTAAAGCTGTGTGGTTGCTGCTTCATATACTTAACGATTACT
CGAGCTAAAAACCTCAGAC
GenBank Accession AL755545 [GenBank]
Graphic View Graphic view of gene At1g55800
Predicted Position of Insertion Chr1:20856757 - go to primer design
BLAST e Value 1e-35
Hit Clone Code (BAC ID) F20N2
Hit Gene Code At1g55800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At1g18880

 
Sequence (A. th genome BLAST matches underlined)
>02-012074-strizhov-B1-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTCTTATC
CCCGGACATTTTGCTGGACTATGATTCACCTACAAACCTTCATACTCTACTTACCNTGCT
ACTTCCTTACTATAAGGCAACTATCACGGATATATTGACCTGACTTTAACGGTTCCTGTG
CCATCCTAATTCTTAGCTTCCTTGATTCTCCAGTGCTGCACCGTATAAACATTTTACGTA
CTCTCCAGTTATGAATTCCATGAAAAACTCCTCTGAATCGGCACAGAGACGACAGGGAAC
GCGTTCTTGGCTATGGGATCCTTCCTATGGAGACTCTGCTNTACTCAACAAGTGGAGGAA
GTTAAATGCGTGATCCGGGTGCTTCCGGTTTGGCTCTCGGCCGCCTTATTCTACCTATGG
GATCCTCCCTATAGTGAGTCGTATTACTGAANNCTNCCTNTANTGAGTNGTATAAACTCA
ANNNNTNNCNCCCCGCTGTTCTGTCCTTNCCCCTGGTCCCCCCCGCCCCCGCGCGGGGCC
CCCGCCCCCCTCTCCCGGGCGGTGGCCGCCGAACCCGACACCCCGGGTAAAATTGCCCCC
CAGGCGAAGCCGAACCGCAGGCACAGCACCGGCCTGAATAGTACGGGAAACCTGCGCTGG
CGCCCATCCGCCGGCGGTGACGCCGGGAACATAGAAAGAATGTAGAGGTCGCGCGAAGGG
GGTCTAGCCCGCGCACCATCCACGGAAAGACCGTGGACACTGCGGGGGCGACACGGGAGC
GAGAGAGAACCCGACCGCCGCAGCTGTATTTAAGGACAAAAGAGCGAAACGCCCCCGGCG
TTTAAAAACCGGCGCGGCATCACATGAGCAAAGGCACGGTGCGACGGGCTGCCCGACGCT
GCCGATCGGCCGAGTCTCCTAAAGCTGTGTGGTTGCTGCTTCATATACTTAACGATTACT
CGAGCTAAAAACCTCAGAC
GenBank Accession AL755545 [GenBank]
Graphic View Graphic view of gene At1g18880
Predicted Position of Insertion Chr1:6522142 - go to primer design
BLAST e Value 9e-33
Hit Clone Code (BAC ID) F6A14
Hit Gene Code At1g18880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40