SimpleSearch - Line and FST details


Line specific information

 
Line ID 099B04
Vector Used pAC161
Line Availability only available from NASC (N409424)
Segregation Analysis 50:50:38
Confirmed for Hit At1g72650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g72650

 
Sequence (A. th genome BLAST matches underlined)
>26-012118-strizhov-B4-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTGCTTTGTGTTCAGGTTTTTGGTGTGAAATTGTACAGAGATG
CTGTCAAATAGTAAAAGAATTGTTTTTTTCTTTGGTAAAGTTATATGTAGTACTGAAACA
TGCTTTGGTAGATTGGTTTTTTTAGTACTTGAAGAATATATTGAGCATATATCAATTTGT
TTGCTTTTTCTCTGTTTGGGATTGCAGATAGTGTGTTCCTAAGTTAGATTTGCGATGGGA
ACTGTGGTTGGAACTGTTGAGGACCGCAGAGATATGTTTGAGGGCAATGCTCAGACAAGG
ATCACACCATTTTCTTCAACAAATCAGATTGGAAATCCTGTTGCCTACAAGCTTGTCCGG
GTATGGCTATAAATGTCTTCTTTTCACTGGCTCTCTTATAGTTAATCCTATTGTTTGATT
TCTGCGTGTGGCTTCTGACTTCTGTGAACTTCTTCCAAGTTAGAACGGGGACCAAATAAT
CTAATANGGGGCTTCTGGATTTGAGAAATCTGTCTATTATGACTATATATATTAGCCAGC
CTTTCAAAATCTTATTTTGGGTTGTTTATGGAAATGGGTTAGGTTCAGGAGATGGGAGTC
TA
GenBank Accession AL755548 [GenBank]
Graphic View Graphic view of gene At1g72650
Predicted Position of Insertion Chr1:27350035 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F28P22
Hit Gene Code At1g72650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TRF-like 6
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40